Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37830
Trapped Gene
Arhgef9 (ENSMUSG00000025656)
Vector Insertion
Chr X: 92327536 - 92361310
Public Clones (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000697314 (ChrX:92360928..92361309 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGCCTCGCTGTGATATGTA ChrX:92360936..92360955 60.24 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000697314 (ChrX:92360928..92361309 -)
Downstram Exon
ENSMUSE00000697309 (ChrX:92327537..92327550 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGCCTCGCTGTGATATGTA ChrX:92360936..92360955 60.24 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000697267 ChrX:92391749..92391844 CAGTGGATTAGAGGCGGAAC ChrX:92391756..92391775 59.69 55
upstream ENSMUSE00000697325 ChrX:92391749..92392160 CAGTTGCGTGTTTCCTTCCT ChrX:92392013..92392032 60.29 50
upstream ENSMUSE00000697316 ChrX:92361763..92361825 GCGTGAATAAAAAGGCAACC ChrX:92361774..92361793 59.59 45
upstream ENSMUSE00000697276 ChrX:92360939..92361646 TCGTTTTTGCCGTGATTGTA ChrX:92361169..92361188 60.11 40
upstream ENSMUSE00000697294 ChrX:92360939..92361700 TCGTTTTTGCCGTGATTGTA ChrX:92361169..92361188 60.11 40
upstream ENSMUSE00000697303 ChrX:92360932..92361309 TGGCCTCGCTGTGATATGTA ChrX:92360936..92360955 60.24 50
upstream ENSMUSE00000697314 ChrX:92360928..92361309 TGGCCTCGCTGTGATATGTA ChrX:92360936..92360955 60.24 50
upstream ENSMUSE00000697319 ChrX:92360928..92361745 TCGTTTTTGCCGTGATTGTA ChrX:92361169..92361188 60.11 40
upstream ENSMUSE00000697364 ChrX:92360928..92361712 TCGTTTTTGCCGTGATTGTA ChrX:92361169..92361188 60.11 40
upstream ENSMUSE00000697309 ChrX:92327537..92327550 No primer for this exon

*** Putative Vector Insertion (Chr X: 92327536 - 92361310) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000697329 ChrX:92327052..92327060 No primer for this exon
downstream ENSMUSE00000550005 ChrX:92326175..92326354 CATGGTGACGTGATCCCATA ChrX:92326276..92326295 60.2 50
downstream ENSMUSE00000697301 ChrX:92326175..92326354 CATGGTGACGTGATCCCATA ChrX:92326276..92326295 60.2 50
downstream ENSMUSE00000697308 ChrX:92326175..92326355 CATGGTGACGTGATCCCATA ChrX:92326276..92326295 60.2 50
downstream ENSMUSE00000550003 ChrX:92307694..92307885 CTCGCAAATGTCCTTGAGGT ChrX:92307672..92307691 60.26 50
downstream ENSMUSE00000550002 ChrX:92296296..92296475 CTTCTCTTTCGGCACTGCTT ChrX:92296425..92296444 59.76 50
downstream ENSMUSE00000549998 ChrX:92276817..92277049 GTTGATAGCGGCTGTCCTTC ChrX:92276934..92276953 59.84 55
downstream ENSMUSE00000549996 ChrX:92272778..92272907 CAAAGCAGCTGCAACGTATC ChrX:92272858..92272877 59.64 50
downstream ENSMUSE00000549995 ChrX:92266512..92266643 CATCTGGTGGTCAAACAGGA ChrX:92266505..92266524 59.52 50
downstream ENSMUSE00000549993 ChrX:92254156..92254399 TGCGCCCCTTGTAGTATAGG ChrX:92254338..92254357 60.11 55
downstream ENSMUSE00000654649 ChrX:92250282..92250350 CAGTCATTGCAGCCTGTCTC ChrX:92250284..92250303 59.58 55
downstream ENSMUSE00000697324 ChrX:92248019..92248129 TGTGCTGAGTTCCTGGTTAGG ChrX:92247998..92248018 60.3 52.38
downstream ENSMUSE00000654647 ChrX:92247334..92247493 CACTTGAGACTGAGCGATGC ChrX:92247368..92247387 59.73 55
downstream ENSMUSE00000697271 ChrX:92247273..92247493 CACTTGAGACTGAGCGATGC ChrX:92247368..92247387 59.73 55
downstream ENSMUSE00000697265 ChrX:92247258..92250350 AGGGAGCTCCTTCTTTTTGC ChrX:92249671..92249690 59.96 50
downstream ENSMUSE00000697327 ChrX:92246520..92246538 No primer for this exon
downstream ENSMUSE00000697322 ChrX:92245605..92247493 CAATTGTGGACACAGGATGC ChrX:92246590..92246609 59.97 50
downstream ENSMUSE00000697312 ChrX:92244283..92247493 GAGAGCGGAGTTGGTAGTGC ChrX:92244891..92244910 60.02 60
downstream ENSMUSE00000697318 ChrX:92244278..92247493 GAGAGCGGAGTTGGTAGTGC ChrX:92244891..92244910 60.02 60
downstream ENSMUSE00000697333 ChrX:92244277..92246538 GAGAGCGGAGTTGGTAGTGC ChrX:92244891..92244910 60.02 60
downstream ENSMUSE00000697291 ChrX:92244276..92247493 GAGAGCGGAGTTGGTAGTGC ChrX:92244891..92244910 60.02 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCATCATGGGGTGGTTGTA ChrX:92331266..92331286 59.62 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCATCATGGGGTGGTTGTA ChrX:92331266..92331286 59.62 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025656