Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37838
Trapped Gene
C1qtnf1 (ENSMUSG00000017446)
Vector Insertion
Chr 11: 118289883 - 118295166
Public Clones (ggtc) (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000151805 (Chr11:118289813..118289882 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGAGGATTTCATTGCACAG Chr11:118289844..118289863 59.65 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000151805 (Chr11:118289813..118289882 +)
Downstram Exon
ENSMUSE00000669334 (Chr11:118295167..118295216 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGAGGATTTCATTGCACAG Chr11:118289844..118289863 59.65 45 CCGCCTATAACAATCCCATC Chr11:118295193..118295212 59.25 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000151805 Chr11:118289813..118289882 TGGAGGATTTCATTGCACAG Chr11:118289844..118289863 59.65 45

*** Putative Vector Insertion (Chr 11: 118289883 - 118295166) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000669334 Chr11:118295167..118295216 CCGCCTATAACAATCCCATC Chr11:118295193..118295212 59.25 50
downstream ENSMUSE00000669331 Chr11:118304848..118304871 CTCGACCAGAGCTGTTGAATC Chr11:118304873..118304893 60.01 52.38
downstream ENSMUSE00000718925 Chr11:118305006..118305164 TCCCACTCCTGTTGTTCCTC Chr11:118305125..118305144 60.09 55
downstream ENSMUSE00000719199 Chr11:118305006..118305164 TCCCACTCCTGTTGTTCCTC Chr11:118305125..118305144 60.09 55
downstream ENSMUSE00000721429 Chr11:118305006..118305164 TCCCACTCCTGTTGTTCCTC Chr11:118305125..118305144 60.09 55
downstream ENSMUSE00000151803 Chr11:118307815..118307954 CATCGGTAGCACCGAGAAGT Chr11:118307889..118307908 60.28 55
downstream ENSMUSE00000669329 Chr11:118307815..118307954 CATCGGTAGCACCGAGAAGT Chr11:118307889..118307908 60.28 55
downstream ENSMUSE00000243461 Chr11:118309115..118311276 GGTGAGATGGGGAAAGAACA Chr11:118311014..118311033 59.9 50
downstream ENSMUSE00000669327 Chr11:118309115..118310104 CACAGCACAGGGTCGTCTAA Chr11:118310004..118310023 59.9 55
downstream ENSMUSE00000669333 Chr11:118309115..118311277 GGTGAGATGGGGAAAGAACA Chr11:118311014..118311033 59.9 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCAGGATATAATCGCCTTGC Chr11:118289926..118289946 59.53 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGAGGATTTCATTGCACAG Chr11:118289845..118289865 59.65 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000017446