Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37843
Trapped Gene
Cntn1 (ENSMUSG00000055022)
Vector Insertion
Chr 15: 91992093 - 92046746
Public Clones (ggtc) (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000510406 (Chr15:91991788..91992092 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGATGATTCAACCCACACG Chr15:91992073..91992092 59.96 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000510406 (Chr15:91991788..91992092 +)
Downstram Exon
ENSMUSE00000452972 (Chr15:92046747..92046878 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGATGATTCAACCCACACG Chr15:91992073..91992092 59.96 50 TTAGCAGGAGATGGCTGACC Chr15:92046857..92046876 60.36 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000480538 Chr15:91958619..91958766 ATAAGTGTGGCGCCTATTGC Chr15:91958728..91958747 60.12 50
upstream ENSMUSE00000510406 Chr15:91991788..91992092 CAGATGATTCAACCCACACG Chr15:91992073..91992092 59.96 50

*** Putative Vector Insertion (Chr 15: 91992093 - 92046746) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000452972 Chr15:92046747..92046878 TTAGCAGGAGATGGCTGACC Chr15:92046857..92046876 60.36 55
downstream ENSMUSE00000710834 Chr15:92046747..92046878 TTAGCAGGAGATGGCTGACC Chr15:92046857..92046876 60.36 55
downstream ENSMUSE00000129048 Chr15:92050878..92050910 No primer for this exon
downstream ENSMUSE00000129047 Chr15:92059054..92059186 CCCAAATCCTTTGTCCTCCT Chr15:92059082..92059101 60.3 50
downstream ENSMUSE00000318661 Chr15:92062532..92062704 CACGTCCCCGTTATTCATTC Chr15:92062559..92062578 60.19 50
downstream ENSMUSE00000318657 Chr15:92064856..92064951 GGGAGGATCACAGAGAAGCA Chr15:92064941..92064960 60.35 55
downstream ENSMUSE00000129046 Chr15:92073322..92073528 GAAGCCAGCGGTAGCTAAGA Chr15:92073348..92073367 59.75 55
downstream ENSMUSE00000129035 Chr15:92076159..92076258 GCACCACAATATCAGCAGGA Chr15:92076197..92076216 59.68 50
downstream ENSMUSE00000129052 Chr15:92076392..92076573 GATTCTTGCCTGGTGCTTGT Chr15:92076566..92076585 60.26 50
downstream ENSMUSE00000318632 Chr15:92081290..92081414 TGATGGTAGGAATGGGCTTC Chr15:92081394..92081413 59.89 50
downstream ENSMUSE00000129044 Chr15:92082828..92082945 AGCTCAGCGTTGGCATAAAT Chr15:92082937..92082956 59.87 45
downstream ENSMUSE00000129040 Chr15:92084341..92084491 TCGCAGCCAAGATCTTTTTC Chr15:92084397..92084416 60.47 45
downstream ENSMUSE00000129055 Chr15:92086278..92086405 TGATCACCAGAGTCCCAGTG Chr15:92086405..92086424 59.66 55
downstream ENSMUSE00000129036 Chr15:92091904..92092085 GAAGGACCACACAAACGTGA Chr15:92092025..92092044 59.57 50
downstream ENSMUSE00000129039 Chr15:92101665..92101785 CATTTCGGATGAGCAGTTCC Chr15:92101701..92101720 60.6 50
downstream ENSMUSE00000129041 Chr15:92122039..92122197 AATCGTCTTGGTCTGGATCG Chr15:92122169..92122188 60.07 50
downstream ENSMUSE00000466066 Chr15:92125419..92125568 AGCACCGTCTGTTTTGATCC Chr15:92125570..92125589 60.12 50
downstream ENSMUSE00000129042 Chr15:92133385..92133455 GCCCACGTTATTGTCAGCTC Chr15:92133457..92133476 60.67 55
downstream ENSMUSE00000508033 Chr15:92135460..92135694 AGGGCCCATCTCCTTTATTG Chr15:92135661..92135680 60.28 50
downstream ENSMUSE00000129037 Chr15:92140386..92140489 TTTGACCCCTACCTCTGTGG Chr15:92140423..92140442 59.96 55
downstream ENSMUSE00000318552 Chr15:92144919..92145105 TGGTGAAGGTCTCGATCACA Chr15:92145099..92145118 60.25 50
downstream ENSMUSE00000129057 Chr15:92147458..92147570 CATTGGATAGTGCCACAACG Chr15:92147550..92147569 59.99 50
downstream ENSMUSE00000129054 Chr15:92148348..92148504 GCTCGAACCTCGACAACATA Chr15:92148460..92148479 58.88 50
downstream ENSMUSE00000511376 Chr15:92169944..92170545 CCTCAGTCGTGATGTGTTGG Chr15:92170179..92170198 60.15 55
downstream ENSMUSE00000513539 Chr15:92169944..92170542 CCTCAGTCGTGATGTGTTGG Chr15:92170179..92170198 60.15 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTATACTCCCCAGGGCAAC Chr15:92019097..92019117 60.85 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTATACTCCCCAGGGCAAC Chr15:92019097..92019117 60.85 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000055022