Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37877
Trapped Gene
Zmynd15 (ENSMUSG00000040829)
Vector Insertion
Chr 11: 70273583 - 70274394
Public Clones (ggtc) (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000677227 (Chr11:70272935..70273582 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AATCCGAGTGAGCAAGCTGT Chr11:70273301..70273320 60.02 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000677227 (Chr11:70272935..70273582 +)
Downstram Exon
ENSMUSE00000677224 (Chr11:70274395..70274642 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AATCCGAGTGAGCAAGCTGT Chr11:70273301..70273320 60.02 50 TCCTGTGGTTCCACCTTCTC Chr11:70274484..70274503 60.09 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000677227 Chr11:70272935..70273582 AATCCGAGTGAGCAAGCTGT Chr11:70273301..70273320 60.02 50
upstream ENSMUSE00000457317 Chr11:70273124..70273582 AATCCGAGTGAGCAAGCTGT Chr11:70273301..70273320 60.02 50

*** Putative Vector Insertion (Chr 11: 70273583 - 70274394) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000457310 Chr11:70274054..70274642 GAGCAGCAAAATCGAGGAAC Chr11:70274123..70274142 59.96 50
downstream ENSMUSE00000588298 Chr11:70274067..70274642 GAGCAGCAAAATCGAGGAAC Chr11:70274123..70274142 59.96 50
downstream ENSMUSE00000677224 Chr11:70274395..70274642 TCCTGTGGTTCCACCTTCTC Chr11:70274484..70274503 60.09 55
downstream ENSMUSE00000457303 Chr11:70275286..70275523 GCGTCTCCTACGGTAAGCTG Chr11:70275514..70275533 60.04 60
downstream ENSMUSE00000578661 Chr11:70275289..70275523 GCGTCTCCTACGGTAAGCTG Chr11:70275514..70275533 60.04 60
downstream ENSMUSE00000355656 Chr11:70275613..70275768 AGTAAAACCTGGCCGAGGAC Chr11:70275700..70275719 60.5 55
downstream ENSMUSE00000322036 Chr11:70276025..70276185 GGAGACAAGCCTCTCCACAG Chr11:70276071..70276090 59.99 60
downstream ENSMUSE00000322028 Chr11:70276941..70277093 TGGGTCCAATAACCACGAGT Chr11:70277016..70277035 60.23 50
downstream ENSMUSE00000322016 Chr11:70277418..70277498 CTCCCTGCAGAAGCTGGTAA Chr11:70277447..70277466 60.53 55
downstream ENSMUSE00000392544 Chr11:70277651..70277767 CCGCCACGTGTAGTAATCCT Chr11:70277682..70277701 60.01 55
downstream ENSMUSE00000322005 Chr11:70277858..70277946 GACGAGATCGAATTCCTTGC Chr11:70277937..70277956 59.78 50
downstream ENSMUSE00000321998 Chr11:70278035..70278133 AATGCTGCTGGTCACTCTCA Chr11:70278122..70278141 59.58 50
downstream ENSMUSE00000321988 Chr11:70278282..70278435 No primer for this exon
downstream ENSMUSE00000321981 Chr11:70278609..70278667 TGAGACCAAAGCCGGAGTTA Chr11:70278635..70278654 60.77 50
downstream ENSMUSE00000321972 Chr11:70278841..70279001 ACCGCCATAGTCTGATCGTC Chr11:70278917..70278936 60.1 55
downstream ENSMUSE00000337571 Chr11:70279417..70279701 AATGGAAGATGAAGGCGTTG Chr11:70279445..70279464 60.07 45
downstream ENSMUSE00000677223 Chr11:70279417..70279704 AATGGAAGATGAAGGCGTTG Chr11:70279445..70279464 60.07 45
downstream ENSMUSE00000677228 Chr11:70279417..70279592 GAAGATGAAGGCGTTGCAGT Chr11:70279441..70279460 60.41 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCTCCAGCACGAGGTATTT Chr11:70273570..70273590 59.69 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCTCCAGCACGAGGTATTT Chr11:70273570..70273590 59.69 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040829