Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3788
Trapped Gene
Endogl1 (ENSMUSG00000042787)
Vector Insertion
Chr 9: 119361461 - 119371493
Public Clones XP0317 (sanger) XL965 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 59% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000220317 (Chr9:119361346..119361460 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGTGAGCTGACGGAGAGATT Chr9:119361362..119361381 60.56 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000220317 (Chr9:119361346..119361460 +)
Downstram Exon
ENSMUSE00000403553 (Chr9:119371494..119374635 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGTGAGCTGACGGAGAGATT Chr9:119361362..119361381 60.56 55 AGTGACCCCACTCAGGTTTG Chr9:119373820..119373839 60 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000363901 Chr9:119354078..119354268 GAGTCATGGCTGCAAAGAGC Chr9:119354101..119354120 61.1 55
upstream ENSMUSE00000220318 Chr9:119356067..119356216 TTGGAACAGTTTGGGTTTCC Chr9:119356087..119356106 59.81 45
upstream ENSMUSE00000220314 Chr9:119357507..119357646 AGCGCCCTCAATGAAGACTA Chr9:119357566..119357585 59.98 50
upstream ENSMUSE00000220313 Chr9:119358896..119358972 AACTCCGGCTACTGGAACAG Chr9:119358953..119358972 59.35 55
upstream ENSMUSE00000220317 Chr9:119361346..119361460 CGTGAGCTGACGGAGAGATT Chr9:119361362..119361381 60.56 55

*** Putative Vector Insertion (Chr 9: 119361461 - 119371493) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000403553 Chr9:119371494..119374635 AGTGACCCCACTCAGGTTTG Chr9:119373820..119373839 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTGCCTTATTTGGGCTTCT Chr9:119367441..119367461 60.71 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGCTTCTGACAGGGAATCT Chr9:119367453..119367473 60.6 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042787