Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37880
Trapped Gene
Ambra1 (ENSMUSG00000040506)
Vector Insertion
Chr 2: 91613905 - 91645180
Public Clones (ggtc) (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 53% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000300727 (Chr2:91612448..91613904 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TACCACCTCTTGAGCGGACT Chr2:91613679..91613698 59.87 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000300727 (Chr2:91612448..91613904 +)
Downstram Exon
ENSMUSE00000300721 (Chr2:91645181..91645267 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TACCACCTCTTGAGCGGACT Chr2:91613679..91613698 59.87 55 TCTGGGTAAATTGGGTGCTC Chr2:91645261..91645280 59.93 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000687440 Chr2:91570295..91570536 GGCGTCTTCTTGGTTGATGT Chr2:91570334..91570353 60.12 50
upstream ENSMUSE00000687424 Chr2:91606602..91606857 TGTGTGGAGCTATTGCTTGC Chr2:91606659..91606678 60.02 50
upstream ENSMUSE00000643254 Chr2:91606604..91606857 TGTGTGGAGCTATTGCTTGC Chr2:91606659..91606678 60.02 50
upstream ENSMUSE00000643252 Chr2:91607214..91607272 TAGTCCACGCTCGACCTTCT Chr2:91607231..91607250 60.01 55
upstream ENSMUSE00000643249 Chr2:91607847..91608030 GCTTCTGGTTGCCTAGATGG Chr2:91607986..91608005 59.84 55
upstream ENSMUSE00000643248 Chr2:91609072..91609244 GCAGTGAAAGCTGGTTCACA Chr2:91609076..91609095 60.03 50
upstream ENSMUSE00000643247 Chr2:91611068..91611134 No primer for this exon
upstream ENSMUSE00000300727 Chr2:91612448..91613904 TACCACCTCTTGAGCGGACT Chr2:91613679..91613698 59.87 55
upstream ENSMUSE00000643246 Chr2:91612448..91612594 TCCTCCACAATTTCCTGCAC Chr2:91612545..91612564 61.05 50
upstream ENSMUSE00000565130 Chr2:91612868..91613904 TACCACCTCTTGAGCGGACT Chr2:91613679..91613698 59.87 55

*** Putative Vector Insertion (Chr 2: 91613905 - 91645180) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000300721 Chr2:91645181..91645267 TCTGGGTAAATTGGGTGCTC Chr2:91645261..91645280 59.93 50
downstream ENSMUSE00000643244 Chr2:91650187..91650366 GAAGAACGAAGCCGATTCTG Chr2:91650297..91650316 59.96 50
downstream ENSMUSE00000643243 Chr2:91664617..91664697 TGGAACAAATCGTCCAAGTG Chr2:91664698..91664717 59.54 45
downstream ENSMUSE00000643242 Chr2:91665409..91665509 AGGCAAGTACTCAGGCAGCA Chr2:91665439..91665458 61.14 55
downstream ENSMUSE00000643241 Chr2:91715873..91715983 ATGTTACTGGCCACAGCAGA Chr2:91715918..91715937 59.32 50
downstream ENSMUSE00000643240 Chr2:91725758..91725946 GTCACAGCTGGCATCATTGT Chr2:91725816..91725835 59.71 50
downstream ENSMUSE00000643239 Chr2:91726981..91727135 TCATGGAAGTCTCACCACCA Chr2:91727136..91727155 60.09 50
downstream ENSMUSE00000687426 Chr2:91740655..91740794 GTCGGCAGATCACCAAGTCT Chr2:91740793..91740812 60.27 55
downstream ENSMUSE00000300675 Chr2:91750454..91750546 CTCGCTGCTCCTGCTACTTG Chr2:91750541..91750560 61.4 60
downstream ENSMUSE00000300669 Chr2:91751571..91751764 TCTGTGTTTCAGCGTTCTGC Chr2:91751716..91751735 60.18 50
downstream ENSMUSE00000347007 Chr2:91757484..91759005 ACGATGATGTTGTTGCCAAA Chr2:91757634..91757653 59.97 40
downstream ENSMUSE00000643236 Chr2:91757484..91759006 ACGATGATGTTGTTGCCAAA Chr2:91757634..91757653 59.97 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGAGGGCAAGCTGTTTATG Chr2:91640860..91640880 59.34 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGAACGTGACTGGGAAAAC Chr2:91640951..91640971 59.04 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040506