Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37881
Trapped Gene
Csnk2a1 (ENSMUSG00000074698)
Vector Insertion
Chr 2: 152101283 - 152102682
Public Clones (ggtc) (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 83% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000681802 (Chr2:152101134..152101282 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCTTCGATATGACCACCAG Chr2:152101220..152101239 59.67 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000681802 (Chr2:152101134..152101282 +)
Downstram Exon
ENSMUSE00000640035 (Chr2:152102683..152102769 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCTTCGATATGACCACCAG Chr2:152101220..152101239 59.67 50 GCCTGGTCCTTCACAACAGT Chr2:152102707..152102726 60.16 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000681813 Chr2:152052618..152052727 CCGCCATATTGTCTGTGTGA Chr2:152052665..152052684 60.54 50
upstream ENSMUSE00000640047 Chr2:152052621..152052727 CCGCCATATTGTCTGTGTGA Chr2:152052665..152052684 60.54 50
upstream ENSMUSE00000640046 Chr2:152076138..152076347 CCAACGTCTGCTTTTGAACA Chr2:152076170..152076189 59.88 45
upstream ENSMUSE00000640045 Chr2:152079946..152080057 TTGAAGCCATCAACATCACAA Chr2:152080005..152080025 60.1 38.1
upstream ENSMUSE00000640044 Chr2:152083114..152083215 CCCAACATCATCACACTTGC Chr2:152083174..152083193 59.97 50
upstream ENSMUSE00000640043 Chr2:152083677..152083727 CCTGCCTTGGTTTTTGAACA Chr2:152083686..152083705 61.03 45
upstream ENSMUSE00000640042 Chr2:152084412..152084471 No primer for this exon
upstream ENSMUSE00000711309 Chr2:152086495..152086578 ACAGCATGGGGATTATGCAC Chr2:152086511..152086530 60.75 50
upstream ENSMUSE00000712610 Chr2:152086495..152086578 ACAGCATGGGGATTATGCAC Chr2:152086511..152086530 60.75 50
upstream ENSMUSE00000640040 Chr2:152088919..152089029 TTTACCATCCAGGCCAAGAG Chr2:152088950..152088969 60.07 50
upstream ENSMUSE00000681807 Chr2:152088919..152089029 TTTACCATCCAGGCCAAGAG Chr2:152088950..152088969 60.07 50
upstream ENSMUSE00000640038 Chr2:152098364..152098465 GGAGCTTGGGTTGTATGCTG Chr2:152098389..152098408 60.66 55
upstream ENSMUSE00000681805 Chr2:152098364..152098465 GGAGCTTGGGTTGTATGCTG Chr2:152098389..152098408 60.66 55
upstream ENSMUSE00000640037 Chr2:152099829..152099929 TGGTGAGGATAGCCAAGGTT Chr2:152099830..152099849 59.55 50
upstream ENSMUSE00000681804 Chr2:152099829..152099929 TGGTGAGGATAGCCAAGGTT Chr2:152099830..152099849 59.55 50
upstream ENSMUSE00000640036 Chr2:152101134..152101282 TGCTTCGATATGACCACCAG Chr2:152101220..152101239 59.67 50
upstream ENSMUSE00000681802 Chr2:152101134..152101282 TGCTTCGATATGACCACCAG Chr2:152101220..152101239 59.67 50

*** Putative Vector Insertion (Chr 2: 152101283 - 152102682) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000640035 Chr2:152102683..152102769 GCCTGGTCCTTCACAACAGT Chr2:152102707..152102726 60.16 55
downstream ENSMUSE00000681801 Chr2:152102683..152102769 GCCTGGTCCTTCACAACAGT Chr2:152102707..152102726 60.16 55
downstream ENSMUSE00000539955 Chr2:152104705..152107581 AGTTATCCACAGCGGTCCAC Chr2:152107079..152107098 60 55
downstream ENSMUSE00000681799 Chr2:152104705..152106074 AAATCCACAAGCAACGGTTC Chr2:152104955..152104974 59.98 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATGGAGCACCCTTACTTCTG Chr2:152101264..152101285 59.74 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074698