Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37900
Trapped Gene
1110036O03Rik (ENSMUSG00000006931)
Vector Insertion
Chr 11: 100274922 - 100275394
Public Clones (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 49% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000112643 (Chr11:100275241..100275393 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGCTGACCGCCAAGTATCT Chr11:100275311..100275330 59.46 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000112643 (Chr11:100275241..100275393 -)
Downstram Exon
ENSMUSE00000112646 (Chr11:100274923..100275094 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGCTGACCGCCAAGTATCT Chr11:100275311..100275330 59.46 55 AAAGTCCCCGCTGTTGTAAA Chr11:100275028..100275047 59.61 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000673002 Chr11:100275741..100276010 GCTCTGGAGCAATACGAAGG Chr11:100275825..100275844 59.98 55
upstream ENSMUSE00000673001 Chr11:100275697..100275738 No primer for this exon
upstream ENSMUSE00000428970 Chr11:100275491..100276011 GCTCTGGAGCAATACGAAGG Chr11:100275825..100275844 59.98 55
upstream ENSMUSE00000673000 Chr11:100275491..100275694 GCCTTTCAAGTCCCTTACCC Chr11:100275561..100275580 59.94 55
upstream ENSMUSE00000112643 Chr11:100275241..100275393 GAGCTGACCGCCAAGTATCT Chr11:100275311..100275330 59.46 55
upstream ENSMUSE00000112646 Chr11:100274923..100275094 CCCACGAGCAGGTAGACTTC Chr11:100274948..100274967 59.87 60

*** Putative Vector Insertion (Chr 11: 100274922 - 100275394) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000112648 Chr11:100274015..100274143 ACCTACGTTGGGGGTGAGAT Chr11:100274057..100274076 60.63 55
downstream ENSMUSE00000248642 Chr11:100273043..100273188 TTCTGCTGCATAACGCTGTC Chr11:100273088..100273107 60.17 50
downstream ENSMUSE00000248634 Chr11:100272428..100272511 GCTCAGAGGTCTGGTTGTGG Chr11:100272456..100272475 60.86 60
downstream ENSMUSE00000520715 Chr11:100270677..100270821 TCTTGCCACCAGTCAGCATA Chr11:100270687..100270706 60.41 50
downstream ENSMUSE00000517893 Chr11:100269770..100270458 GTCTGCGGTTCAAAGACACA Chr11:100269963..100269982 59.88 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGATAATCGCCTTGCAGCAC Chr11:100275326..100275346 60.38 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTACACCTTCCTCCAGACG Chr11:100275341..100275361 59.72 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000006931