Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37901
Trapped Gene
Plec1 (ENSMUSG00000022565)
Vector Insertion
Chr 15: 76036027 - 76038684
Public Clones (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000623180 (Chr15:76038492..76038683 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGAGATCATTAGGGGATGG Chr15:76038494..76038513 59.7 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000623180 (Chr15:76038492..76038683 -)
Downstram Exon
ENSMUSE00000471415 (Chr15:76036028..76036751 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGAGATCATTAGGGGATGG Chr15:76038494..76038513 59.7 50 GCTCCGGTTCTAAGCACAAG Chr15:76036667..76036686 60.01 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000559353 Chr15:76061604..76061808 CGAAGTGGAGGTGGTTCTGT Chr15:76061657..76061676 60.15 55
upstream ENSMUSE00000559019 Chr15:76059788..76059927 GAGGTGCGGGAGAAGTACAA Chr15:76059790..76059809 60.26 55
upstream ENSMUSE00000466268 Chr15:76039395..76039595 ACGAGATCAGCTCCCTCAAA Chr15:76039396..76039415 59.95 50
upstream ENSMUSE00000623212 Chr15:76038854..76039083 TGGCTCTTTGTCCAGGGTTA Chr15:76038974..76038993 60.63 50
upstream ENSMUSE00000623180 Chr15:76038492..76038683 TGGAGATCATTAGGGGATGG Chr15:76038494..76038513 59.7 50
upstream ENSMUSE00000471415 Chr15:76036028..76036751 ATGAGGTGCTCTTCCGTGAG Chr15:76036503..76036522 60.41 55

*** Putative Vector Insertion (Chr 15: 76036027 - 76038684) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000366194 Chr15:76029979..76030265 AGTGACAACATGACCCACGA Chr15:76030012..76030031 60.01 50
downstream ENSMUSE00000513487 Chr15:76028410..76028639 CACAACAGAGTTGCCCGTAG Chr15:76028391..76028410 59.36 55
downstream ENSMUSE00000401097 Chr15:76025854..76026140 CAGCCAGGTAGAGGTTGTCC Chr15:76025859..76025878 59.72 60
downstream ENSMUSE00000648409 Chr15:76025181..76025242 TTTCTTCTGCACACGGTCTC Chr15:76025195..76025214 59.01 50
downstream ENSMUSE00000648470 Chr15:76025181..76025242 TTTCTTCTGCACACGGTCTC Chr15:76025195..76025214 59.01 50
downstream ENSMUSE00000648396 Chr15:76024989..76025003 No primer for this exon
downstream ENSMUSE00000648408 Chr15:76024771..76024860 GGTCACTGATGTGCCTCTGA Chr15:76024817..76024836 59.83 55
downstream ENSMUSE00000648468 Chr15:76024771..76024860 GGTCACTGATGTGCCTCTGA Chr15:76024817..76024836 59.83 55
downstream ENSMUSE00000682091 Chr15:76024396..76024431 AGGCGCACACTCCTGATTAC Chr15:76024375..76024394 60.28 55
downstream ENSMUSE00000648403 Chr15:76023840..76023917 CTGGCGATGTCGGAGATAGT Chr15:76023818..76023837 60.24 55
downstream ENSMUSE00000648465 Chr15:76023840..76023917 CTGGCGATGTCGGAGATAGT Chr15:76023818..76023837 60.24 55
downstream ENSMUSE00000648464 Chr15:76023651..76023743 GTGCAGGATGATTGTCCAGA Chr15:76023635..76023654 59.64 50
downstream ENSMUSE00000648463 Chr15:76022611..76022777 GTCCGCTCACCTGAATGTCT Chr15:76022731..76022750 60.27 55
downstream ENSMUSE00000648462 Chr15:76021850..76021965 CGAGAATGCCTGGTCTAGGT Chr15:76021874..76021893 59.31 55
downstream ENSMUSE00000648459 Chr15:76021672..76021778 No primer for this exon
downstream ENSMUSE00000648458 Chr15:76021447..76021566 GAACTTGCGCTCCTCAAAAG Chr15:76021449..76021468 60.13 50
downstream ENSMUSE00000648457 Chr15:76021279..76021374 GGTTTTTGTCTGCCTCCTTG Chr15:76021286..76021305 59.71 50
downstream ENSMUSE00000648456 Chr15:76020889..76021016 CCCACTCCTTCTCCACATCT Chr15:76020925..76020944 59.1 55
downstream ENSMUSE00000648454 Chr15:76020532..76020625 CACAATGCGCTGAAGACACT Chr15:76020579..76020598 60.06 50
downstream ENSMUSE00000648452 Chr15:76019687..76019841 TGAACAACAGCCGGATCATA Chr15:76019723..76019742 60.07 45
downstream ENSMUSE00000648451 Chr15:76019301..76019610 CTATTCGACGCTGGTTCTCC Chr15:76019398..76019417 59.84 55
downstream ENSMUSE00000648448 Chr15:76019138..76019215 GACCTAGGCAGTCCCGGTAG Chr15:76019145..76019164 61.03 65
downstream ENSMUSE00000648447 Chr15:76018894..76019055 CACTCCAATCAAAGCCCACT Chr15:76018913..76018932 60.11 50
downstream ENSMUSE00000648443 Chr15:76018603..76018707 CATTTCCAGTTCTCGCATCA Chr15:76018662..76018681 59.8 45
downstream ENSMUSE00000648440 Chr15:76018409..76018504 GCTTCAATGCAGCAACACAG Chr15:76018418..76018437 60.61 50
downstream ENSMUSE00000648438 Chr15:76018067..76018192 CTTCCTGCGTAACGTCTCCT Chr15:76018105..76018124 59.5 55
downstream ENSMUSE00000648437 Chr15:76017041..76017193 CAACTGCACAATAGCCTTGG Chr15:76017094..76017113 59.34 50
downstream ENSMUSE00000648436 Chr15:76016790..76016944 AACCACTGAGCACCTTCCAG Chr15:76016847..76016866 60.3 55
downstream ENSMUSE00000648435 Chr15:76016571..76016697 GGACCGGATGAGCTGTATGT Chr15:76016564..76016583 59.96 55
downstream ENSMUSE00000648431 Chr15:76016284..76016467 TCTGCCACTAGACGGTCCTC Chr15:76016321..76016340 60.41 60
downstream ENSMUSE00000648424 Chr15:76016039..76016196 GCACAGTCCGAGTCTCACAG Chr15:76016085..76016104 59.6 60
downstream ENSMUSE00000648420 Chr15:76015741..76015919 CCAGGTAGATGGCAGACAGG Chr15:76015723..76015742 60.67 60
downstream ENSMUSE00000648419 Chr15:76014397..76014535 TACTGCGAATCACCAAGCTG Chr15:76014482..76014501 60.01 50
downstream ENSMUSE00000648417 Chr15:76013953..76014309 CCCCGCAACTCATCTCTTAG Chr15:76014223..76014242 59.83 55
downstream ENSMUSE00000648416 Chr15:76013792..76013875 CTTCTCACCATGACGCTCAA Chr15:76013818..76013837 59.98 50
downstream ENSMUSE00000648415 Chr15:76013521..76013625 TCCGATCCAGACTGAACCTT Chr15:76013515..76013534 59.65 50
downstream ENSMUSE00000648414 Chr15:76013340..76013438 CGAAGGGTCTCACTGATGAA Chr15:76013337..76013356 58.8 50
downstream ENSMUSE00000648413 Chr15:76008949..76012329 GTAACTTCGCCTCCTGCTTG Chr15:76008947..76008966 60.01 55
downstream ENSMUSE00000648412 Chr15:76001406..76008815 GTGAGGTTCTCGTGGGTGTT Chr15:76005657..76005676 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATTCCTACCCGTTGCTTCTG Chr15:76038653..76038673 59.19 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATTCCTACCCGTTGCTTCTG Chr15:76038653..76038673 59.19 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022565