Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37932
Trapped Gene
Gabpb1 (ENSMUSG00000027361)
Vector Insertion
Chr 2: 126501091 - 126501281
Public Clones (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000661644 (Chr2:126501092..126501280 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GACTTTTCGGTGGGGATTTT Chr2:126501250..126501269 60.17 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000661644 (Chr2:126501092..126501280 -)
Downstram Exon
ENSMUSE00000398603 (Chr2:126501092..126501304 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GACTTTTCGGTGGGGATTTT Chr2:126501250..126501269 60.17 45 CAAAATCCCCACCGAAAAGT Chr2:126501227..126501246 61.07 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000683920 Chr2:126501770..126502073 TGAAGAGGACAGGCATCCTT Chr2:126501823..126501842 59.8 50
upstream ENSMUSE00000398603 Chr2:126501092..126501304 GACTTTTCGGTGGGGATTTT Chr2:126501250..126501269 60.17 45
upstream ENSMUSE00000597120 Chr2:126501092..126501191 No primer for this exon
upstream ENSMUSE00000661644 Chr2:126501092..126501280 GACTTTTCGGTGGGGATTTT Chr2:126501250..126501269 60.17 45
upstream ENSMUSE00000661647 Chr2:126501092..126501328 GACTTTTCGGTGGGGATTTT Chr2:126501250..126501269 60.17 45

*** Putative Vector Insertion (Chr 2: 126501091 - 126501281) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000661643 Chr2:126488727..126488824 AGCTGGTCAGCAGGTAGGAG Chr2:126488778..126488797 59.62 60
downstream ENSMUSE00000641451 Chr2:126484206..126484313 CCATCAAAATGCGAACTTCA Chr2:126484213..126484232 59.66 40
downstream ENSMUSE00000718562 Chr2:126484206..126484313 CCATCAAAATGCGAACTTCA Chr2:126484213..126484232 59.66 40
downstream ENSMUSE00000168730 Chr2:126479291..126479458 TCGGAGAAGAACCTCTGTGG Chr2:126479368..126479387 60.38 55
downstream ENSMUSE00000168732 Chr2:126477969..126478163 AAAGCTCCACCACCTCTTGA Chr2:126478051..126478070 59.84 50
downstream ENSMUSE00000168727 Chr2:126476245..126476356 GTGTGGCAGCGTGTATTGTC Chr2:126476265..126476284 60.19 55
downstream ENSMUSE00000168731 Chr2:126475804..126475917 No primer for this exon
downstream ENSMUSE00000597119 Chr2:126475804..126475917 No primer for this exon
downstream ENSMUSE00000641435 Chr2:126473484..126475917 GGTGCTGAGGCTTCAAACTC Chr2:126475125..126475144 60 55
downstream ENSMUSE00000322272 Chr2:126472299..126472484 TCTGCGGTAACCACTTCCTC Chr2:126472432..126472451 60.26 55
downstream ENSMUSE00000597113 Chr2:126472299..126472484 TCTGCGGTAACCACTTCCTC Chr2:126472432..126472451 60.26 55
downstream ENSMUSE00000661646 Chr2:126472299..126472481 TCTGCGGTAACCACTTCCTC Chr2:126472432..126472451 60.26 55
downstream ENSMUSE00000322266 Chr2:126464965..126465080 CCCGGCTCTCAATTATTTCC Chr2:126464963..126464982 60.76 50
downstream ENSMUSE00000597117 Chr2:126464965..126465080 CCCGGCTCTCAATTATTTCC Chr2:126464963..126464982 60.76 50
downstream ENSMUSE00000661640 Chr2:126464917..126465080 CCCGGCTCTCAATTATTTCC Chr2:126464963..126464982 60.76 50
downstream ENSMUSE00000683919 Chr2:126464372..126465080 TTGAGGGCTTGCCATATGTT Chr2:126464752..126464771 60.47 45
downstream ENSMUSE00000661642 Chr2:126454651..126456118 ATGGTCGCCAGTAAAACCAG Chr2:126455211..126455230 59.99 50
downstream ENSMUSE00000597112 Chr2:126454649..126456118 ATGGTCGCCAGTAAAACCAG Chr2:126455211..126455230 59.99 50
downstream ENSMUSE00000358516 Chr2:126453178..126456118 ATGGTCGCCAGTAAAACCAG Chr2:126455211..126455230 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr2:126501211..126501231 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTTTCGGTGGGGATTTTGG Chr2:126501246..126501266 63.62 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027361