Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3795
Trapped Gene
Rplp1 (ENSMUSG00000007892)
Vector Insertion
Chr 9: 61761329 - 61761694
Public Clones XP0164 (sanger) CMHD-GT_397D7-3 (cmhd) CMHD-GT_384G3-3 (cmhd) PST19617-NR (escells)
Private Clones not available
Severity of mutation (?) Insertion after 43% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000503573 (Chr9:61761695..61761769 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000503573 (Chr9:61761695..61761769 -)
Downstram Exon
ENSMUSE00000222321 (Chr9:61761091..61761328 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000361273 Chr9:61762164..61762345 No primer for this exon
upstream ENSMUSE00000503573 Chr9:61761695..61761769 No primer for this exon

*** Putative Vector Insertion (Chr 9: 61761329 - 61761694) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000222321 Chr9:61761091..61761328 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCACCACCAGCCTTTAATC Chr9:61761638..61761658 59.93 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTACGATTTCCACCACCAG Chr9:61761647..61761667 59.42 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CGTTTGTGTTCCAGGAGGAT Chr9:61761762..61761782 59.97 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CGTTTGTGTTCCAGGAGGAT Chr9:61761762..61761782 59.97 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000007892