Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37950
Trapped Gene
4933439C10Rik (ENSMUSG00000072893)
Vector Insertion
Chr 11: 59321441 - 59323155
Public Clones (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000652934 (Chr11:59321333..59321440 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGTGACCTCTCTGTGCTTCA Chr11:59321420..59321439 60.18 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000652934 (Chr11:59321333..59321440 +)
Downstram Exon
ENSMUSE00000652933 (Chr11:59323156..59323252 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGTGACCTCTCTGTGCTTCA Chr11:59321420..59321439 60.18 55 AGCAATGAGCTCCAGCAAGT Chr11:59323240..59323259 60.16 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000652936 Chr11:59319198..59320388 TATGGGGTTTCTGTCGCTTC Chr11:59319246..59319265 60.07 50
upstream ENSMUSE00000652935 Chr11:59320693..59320814 TGGGACAATCTCTTCCGACT Chr11:59320790..59320809 59.65 50
upstream ENSMUSE00000652934 Chr11:59321333..59321440 CGTGACCTCTCTGTGCTTCA Chr11:59321420..59321439 60.18 55

*** Putative Vector Insertion (Chr 11: 59321441 - 59323155) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000652933 Chr11:59323156..59323252 AGCAATGAGCTCCAGCAAGT Chr11:59323240..59323259 60.16 50
downstream ENSMUSE00000677960 Chr11:59324222..59324887 GATCGCGGTAAGCTGTTCTC Chr11:59324664..59324683 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr11:59321492..59321512 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000072893