Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37953
Trapped Gene
Adrm1 (ENSMUSG00000039041)
Vector Insertion
Chr 2: 179906394 - 179906738
Public Clones (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000345677 (Chr2:179906332..179906393 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000345677 (Chr2:179906332..179906393 +)
Downstram Exon
ENSMUSE00000383513 (Chr2:179906739..179906952 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GGGGTGACCGTAGTTCCTTT Chr2:179906861..179906880 60.22 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000345677 Chr2:179906332..179906393 No primer for this exon

*** Putative Vector Insertion (Chr 2: 179906394 - 179906738) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000383513 Chr2:179906739..179906952 GGGGTGACCGTAGTTCCTTT Chr2:179906861..179906880 60.22 55
downstream ENSMUSE00000227145 Chr2:179907561..179907677 TGAGGTACCCGCTTGAACTC Chr2:179907610..179907629 60.26 55
downstream ENSMUSE00000392947 Chr2:179908615..179908738 GGGGTTGTTCAGACACTCGT Chr2:179908680..179908699 60.01 55
downstream ENSMUSE00000379407 Chr2:179909014..179909100 TGTGACTCATGTTCCCCAAC Chr2:179909058..179909077 59.37 50
downstream ENSMUSE00000357944 Chr2:179909570..179909651 No primer for this exon
downstream ENSMUSE00000406872 Chr2:179909570..179909651 No primer for this exon
downstream ENSMUSE00000381833 Chr2:179909865..179910097 TGTGCTGGTTCCATTACCTG Chr2:179910006..179910025 59.57 50
downstream ENSMUSE00000227133 Chr2:179909948..179910097 TGTGCTGGTTCCATTACCTG Chr2:179910006..179910025 59.57 50
downstream ENSMUSE00000227126 Chr2:179910303..179910460 ATGATCTCTGGGGTCAGCAC Chr2:179910339..179910358 60.08 55
downstream ENSMUSE00000227120 Chr2:179910559..179910661 CAAGGCCGCACTGAACATAC Chr2:179910588..179910607 61.63 55
downstream ENSMUSE00000468783 Chr2:179910779..179910989 GTCCGATTTGGCATTGTTCT Chr2:179910828..179910847 59.94 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAATCGCCTTGCAGCACAT Chr2:179906444..179906464 61.32 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000039041