Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37955
Trapped Gene
Igsf3 (ENSMUSG00000042035)
Vector Insertion
Chr 3: 101239656 - 101243297
Public Clones (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 45% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000244853 (Chr3:101239254..101239655 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGTCGTCCTTGAGGGAGAG Chr3:101239290..101239309 59.83 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000244853 (Chr3:101239254..101239655 +)
Downstram Exon
ENSMUSE00000456935 (Chr3:101243298..101243702 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGTCGTCCTTGAGGGAGAG Chr3:101239290..101239309 59.83 60 CCTCCATCTCGTGTGAAGGT Chr3:101243484..101243503 60.11 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000503310 Chr3:101181048..101181125 No primer for this exon
upstream ENSMUSE00000456978 Chr3:101181729..101182415 CGAATGAGCGATCTCAGACA Chr3:101181944..101181963 60.1 50
upstream ENSMUSE00000456959 Chr3:101229374..101229751 TGAGCGCTACTTTGGGAGTT Chr3:101229708..101229727 60.01 50
upstream ENSMUSE00000456951 Chr3:101230953..101231363 GAAGCACCTTTCGTCTCACC Chr3:101231208..101231227 59.85 55
upstream ENSMUSE00000456946 Chr3:101235127..101235516 AAAGAGTTCACCGTGCGTCT Chr3:101235129..101235148 59.91 50
upstream ENSMUSE00000244853 Chr3:101239254..101239655 GTGTCGTCCTTGAGGGAGAG Chr3:101239290..101239309 59.83 60

*** Putative Vector Insertion (Chr 3: 101239656 - 101243297) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000456935 Chr3:101243298..101243702 CCTCCATCTCGTGTGAAGGT Chr3:101243484..101243503 60.11 55
downstream ENSMUSE00000370610 Chr3:101254807..101255217 CGTAGGTCCCGTACTCGAAG Chr3:101255013..101255032 59.75 60
downstream ENSMUSE00000456923 Chr3:101259028..101259435 GTCCTGTACCGCCACATTCT Chr3:101259326..101259345 60 55
downstream ENSMUSE00000456919 Chr3:101261546..101262031 TAGGGAATACCAGGCCACAG Chr3:101261679..101261698 59.95 55
downstream ENSMUSE00000515848 Chr3:101263710..101264773 TCCGGCTGAAGGAAGAGATA Chr3:101264614..101264633 59.91 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCTATCACAGCCCTTGGTGA Chr3:101242641..101242661 59.24 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTCAGACTCCTTCCCGTGAC Chr3:101242693..101242713 59.69 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042035