Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3796
Trapped Gene
B230112C05Rik (ENSMUSG00000041817)
Vector Insertion
Chr 13: 97892848 - 97896450
Public Clones XP0159 (sanger) RRO113 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 73% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000297764 (Chr13:97892647..97892847 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAAGACGAGGACTCCACCAG Chr13:97892713..97892732 59.83 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000297764 (Chr13:97892647..97892847 +)
Downstram Exon
ENSMUSE00000397821 (Chr13:97896451..97899470 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAAGACGAGGACTCCACCAG Chr13:97892713..97892732 59.83 60 GGCGCGTCTTCAAGTTCTAC Chr13:97896782..97896801 60.02 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000611533 Chr13:97841598..97841666 No primer for this exon
upstream ENSMUSE00000297815 Chr13:97861773..97861907 GATAACTGCACGCATGAGGA Chr13:97861800..97861819 59.83 50
upstream ENSMUSE00000297810 Chr13:97863546..97863645 TTTGCGCCTGAAGATTCTCT Chr13:97863621..97863640 60.1 45
upstream ENSMUSE00000297805 Chr13:97864017..97864102 GGTGGGCCATTGATGATATT Chr13:97864044..97864063 59.47 45
upstream ENSMUSE00000297802 Chr13:97867495..97867666 GAGGCCGTTGGGTTTTATTC Chr13:97867633..97867652 60.67 50
upstream ENSMUSE00000569672 Chr13:97876909..97877088 TGGCTTACGGTACCCACTGT Chr13:97877051..97877070 60.43 55
upstream ENSMUSE00000569671 Chr13:97879978..97880106 GTACCAGTCACCCGAGCATT Chr13:97880061..97880080 60 55
upstream ENSMUSE00000297785 Chr13:97881251..97881357 ACCTGGACTGGACGACACTC Chr13:97881321..97881340 60.16 60
upstream ENSMUSE00000297780 Chr13:97883594..97883633 TGCCTTTGCTAGCACTTCTG Chr13:97883611..97883630 59.37 50
upstream ENSMUSE00000297775 Chr13:97884064..97884214 CTCCTGTTTCCACGCGTACT Chr13:97884076..97884095 60.31 55
upstream ENSMUSE00000297771 Chr13:97888330..97888486 ATGCTGCACGAACATCAGAG Chr13:97888338..97888357 60.02 50
upstream ENSMUSE00000297764 Chr13:97892647..97892847 GAAGACGAGGACTCCACCAG Chr13:97892713..97892732 59.83 60

*** Putative Vector Insertion (Chr 13: 97892848 - 97896450) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000397821 Chr13:97896451..97899470 GGCGCGTCTTCAAGTTCTAC Chr13:97896782..97896801 60.02 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTAGGTTAATCGCCTTGCAG Chr13:97892893..97892913 58.07 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGCCACTTAGGTCGTGACTG Chr13:97895886..97895907 60.76 57.14 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041817