Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37971
Trapped Gene
Rundc3a (ENSMUSG00000006575)
Vector Insertion
Chr 11: 102254716 - 102255097
Public Clones (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000672132 (Chr11:102254717..102255096 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000672132 (Chr11:102254717..102255096 +)
Downstram Exon
ENSMUSE00000672137 (Chr11:102254817..102255096 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC

*** Putative Vector Insertion (Chr 11: 102254716 - 102255097) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000672132 Chr11:102254717..102255096 No primer for this exon
downstream ENSMUSE00000672137 Chr11:102254817..102255096 No primer for this exon
downstream ENSMUSE00000398684 Chr11:102254990..102255096 No primer for this exon
downstream ENSMUSE00000235720 Chr11:102258885..102259000 No primer for this exon
downstream ENSMUSE00000235716 Chr11:102259399..102259547 No primer for this exon
downstream ENSMUSE00000672131 Chr11:102259414..102259547 No primer for this exon
downstream ENSMUSE00000113234 Chr11:102259691..102259776 No primer for this exon
downstream ENSMUSE00000113231 Chr11:102260509..102260598 No primer for this exon
downstream ENSMUSE00000113236 Chr11:102260697..102260777 No primer for this exon
downstream ENSMUSE00000519701 Chr11:102260929..102261094 No primer for this exon
downstream ENSMUSE00000235680 Chr11:102261202..102261359 No primer for this exon
downstream ENSMUSE00000672136 Chr11:102261951..102262112 No primer for this exon
downstream ENSMUSE00000113239 Chr11:102261975..102262112 No primer for this exon
downstream ENSMUSE00000235667 Chr11:102262208..102262314 No primer for this exon
downstream ENSMUSE00000672130 Chr11:102262703..102263068 No primer for this exon
downstream ENSMUSE00000672135 Chr11:102262703..102263066 No primer for this exon
downstream ENSMUSE00000484735 Chr11:102263295..102263867 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr11:102254766..102254786 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000006575