Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37978
Trapped Gene
Nalcn (ENSMUSG00000000197)
Vector Insertion
Chr 14: 123808917 - 123859651
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 45% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000646575 (Chr14:123859459..123859650 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000646575 (Chr14:123859459..123859650 -)
Downstram Exon
ENSMUSE00000646573 (Chr14:123808918..123809055 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000459183 Chr14:124026038..124026366 No primer for this exon
upstream ENSMUSE00000506043 Chr14:123999065..123999211 No primer for this exon
upstream ENSMUSE00000646588 Chr14:123995693..123995875 No primer for this exon
upstream ENSMUSE00000646585 Chr14:123993708..123993791 No primer for this exon
upstream ENSMUSE00000646584 Chr14:123992134..123992273 No primer for this exon
upstream ENSMUSE00000646583 Chr14:123991904..123992032 No primer for this exon
upstream ENSMUSE00000646581 Chr14:123971162..123971316 No primer for this exon
upstream ENSMUSE00000646579 Chr14:123914853..123914995 No primer for this exon
upstream ENSMUSE00000646578 Chr14:123914523..123914627 No primer for this exon
upstream ENSMUSE00000646577 Chr14:123906703..123906789 No primer for this exon
upstream ENSMUSE00000646576 Chr14:123885608..123885739 No primer for this exon
upstream ENSMUSE00000611485 Chr14:123863886..123864053 No primer for this exon
upstream ENSMUSE00000646575 Chr14:123859459..123859650 No primer for this exon
upstream ENSMUSE00000646573 Chr14:123808918..123809055 No primer for this exon

*** Putative Vector Insertion (Chr 14: 123808917 - 123859651) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000646572 Chr14:123795429..123795503 No primer for this exon
downstream ENSMUSE00000646571 Chr14:123770700..123770836 No primer for this exon
downstream ENSMUSE00000646570 Chr14:123769160..123769301 No primer for this exon
downstream ENSMUSE00000646569 Chr14:123747984..123748057 No primer for this exon
downstream ENSMUSE00000611478 Chr14:123723013..123723114 No primer for this exon
downstream ENSMUSE00000611477 Chr14:123722522..123722591 No primer for this exon
downstream ENSMUSE00000611476 Chr14:123720682..123720773 No primer for this exon
downstream ENSMUSE00000611475 Chr14:123720476..123720598 No primer for this exon
downstream ENSMUSE00000611474 Chr14:123717056..123717112 No primer for this exon
downstream ENSMUSE00000611473 Chr14:123716443..123716563 No primer for this exon
downstream ENSMUSE00000611472 Chr14:123716217..123716348 No primer for this exon
downstream ENSMUSE00000611471 Chr14:123715206..123715373 No primer for this exon
downstream ENSMUSE00000611470 Chr14:123713254..123713358 No primer for this exon
downstream ENSMUSE00000611469 Chr14:123707551..123707657 No primer for this exon
downstream ENSMUSE00000611468 Chr14:123702102..123702222 No primer for this exon
downstream ENSMUSE00000611467 Chr14:123701920..123702018 No primer for this exon
downstream ENSMUSE00000611466 Chr14:123699122..123699215 No primer for this exon
downstream ENSMUSE00000611440 Chr14:123698650..123698836 No primer for this exon
downstream ENSMUSE00000611465 Chr14:123698370..123698476 No primer for this exon
downstream ENSMUSE00000151566 Chr14:123698093..123698167 No primer for this exon
downstream ENSMUSE00000151562 Chr14:123697248..123697367 No primer for this exon
downstream ENSMUSE00000223246 Chr14:123694615..123694683 No primer for this exon
downstream ENSMUSE00000151571 Chr14:123693556..123693704 No primer for this exon
downstream ENSMUSE00000151554 Chr14:123692650..123692743 No primer for this exon
downstream ENSMUSE00000151577 Chr14:123690954..123691086 No primer for this exon
downstream ENSMUSE00000151573 Chr14:123690189..123690304 No primer for this exon
downstream ENSMUSE00000151553 Chr14:123686932..123687089 No primer for this exon
downstream ENSMUSE00000151559 Chr14:123684435..123684585 No primer for this exon
downstream ENSMUSE00000151570 Chr14:123682806..123682958 No primer for this exon
downstream ENSMUSE00000151575 Chr14:123680322..123680439 No primer for this exon
downstream ENSMUSE00000611464 Chr14:123675863..123677583 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr14:123829581..123829601 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTAAATCCGTGACTGGGAAAA Chr14:123853586..123853607 59.44 38.1 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000000197