Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37980
Trapped Gene
Gucy1a2 (ENSMUSG00000041624)
Vector Insertion
Chr 9: 3759882 - 3797237
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 49% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000261056 (Chr9:3759396..3759881 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCTCAGTGTACTCCCATGC Chr9:3759791..3759810 59.86 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000261056 (Chr9:3759396..3759881 +)
Downstram Exon
ENSMUSE00000261038 (Chr9:3797238..3797381 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCTCAGTGTACTCCCATGC Chr9:3759791..3759810 59.86 55 TTTCCATCGGGAGTCAGAAC Chr9:3797374..3797393 60.05 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000503355 Chr9:3532354..3533099 CAGCAGCATGTCTCGAAGAA Chr9:3532796..3532815 60.29 50
upstream ENSMUSE00000261127 Chr9:3579518..3579579 No primer for this exon
upstream ENSMUSE00000261112 Chr9:3582579..3582700 TGCAGACCATTCCAACAAAG Chr9:3582630..3582649 59.69 45
upstream ENSMUSE00000585153 Chr9:3634439..3635157 AGGGCCTACGGAAACAACTT Chr9:3634982..3635001 60 50
upstream ENSMUSE00000703981 Chr9:3634439..3635161 AGGGCCTACGGAAACAACTT Chr9:3634982..3635001 60 50
upstream ENSMUSE00000703980 Chr9:3635972..3635981 No primer for this exon
upstream ENSMUSE00000703979 Chr9:3636707..3636723 No primer for this exon
upstream ENSMUSE00000703978 Chr9:3637253..3637260 No primer for this exon
upstream ENSMUSE00000703977 Chr9:3758917..3758925 No primer for this exon
upstream ENSMUSE00000261056 Chr9:3759396..3759881 TGCTCAGTGTACTCCCATGC Chr9:3759791..3759810 59.86 55

*** Putative Vector Insertion (Chr 9: 3759882 - 3797237) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000261038 Chr9:3797238..3797381 TTTCCATCGGGAGTCAGAAC Chr9:3797374..3797393 60.05 50
downstream ENSMUSE00000261015 Chr9:3865358..3865512 GACATTGATACGCCGAGGAT Chr9:3865498..3865517 59.92 50
downstream ENSMUSE00000407368 Chr9:3894504..3897342 GGCAAAATTGCCTGACAGAT Chr9:3895778..3895797 60.08 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GATCACCAGTGTGGCCTTTT Chr9:3783850..3783870 59.97 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GATCACCAGTGTGGCCTTTT Chr9:3783850..3783870 59.97 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041624