Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI37995
Trapped Gene
Nlrp1b (ENSMUSG00000070390)
Vector Insertion
Chr 11: 70986460 - 70996367
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 51% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000517383 (Chr11:70994692..70996366 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTCCCTAACAATCCCAGTGC Chr11:70995425..70995444 59.93 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000517383 (Chr11:70994692..70996366 -)
Downstram Exon
ENSMUSE00000511915 (Chr11:70986461..70986631 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTCCCTAACAATCCCAGTGC Chr11:70995425..70995444 59.93 50 TTAGTTGGCAGCCAGGGTAT Chr11:70986449..70986468 59.59 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000677052 Chr11:71044200..71044229 No primer for this exon
upstream ENSMUSE00000677051 Chr11:71041819..71042128 AGTATCCGAGAGCTCCGTCA Chr11:71041972..71041991 59.97 55
upstream ENSMUSE00000588160 Chr11:71030359..71032024 TGTCACGTGAGGAGTCTTCG Chr11:71030413..71030432 60.02 55
upstream ENSMUSE00000677037 Chr11:71014650..71014800 AGCTGATGGAGCTCAAAACC Chr11:71014675..71014694 59.43 50
upstream ENSMUSE00000517383 Chr11:70994692..70996366 TTCCCTAACAATCCCAGTGC Chr11:70995425..70995444 59.93 50
upstream ENSMUSE00000651254 Chr11:70994692..70996370 TTCCCTAACAATCCCAGTGC Chr11:70995425..70995444 59.93 50
upstream ENSMUSE00000511915 Chr11:70986461..70986631 CCTGGCTGCCAACTAAAGAC Chr11:70986467..70986486 59.88 55

*** Putative Vector Insertion (Chr 11: 70986460 - 70996367) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000677034 Chr11:70985864..70985897 No primer for this exon
downstream ENSMUSE00000677050 Chr11:70985567..70985737 ACACCATCGTCACACAGGTC Chr11:70985599..70985618 59.42 55
downstream ENSMUSE00000677049 Chr11:70983234..70983323 TGTAATCACCTGGGCACTGA Chr11:70983265..70983284 60.11 50
downstream ENSMUSE00000677048 Chr11:70982305..70982387 TGCTGCTTGAATGAGGTCAG Chr11:70982297..70982316 60.14 50
downstream ENSMUSE00000677046 Chr11:70979069..70979168 CCTATAGGGCCCCAGAAGTC Chr11:70979092..70979111 59.92 60
downstream ENSMUSE00000677044 Chr11:70977475..70977698 CCAGGCACAGAATTCGATCT Chr11:70977577..70977596 60.22 50
downstream ENSMUSE00000677043 Chr11:70975175..70975437 TTCACCCTATCTGGCGTTTC Chr11:70975334..70975353 60.07 50
downstream ENSMUSE00000677042 Chr11:70974568..70974693 GGGAGCCAATGAAAAGATTG Chr11:70974590..70974609 59.51 45
downstream ENSMUSE00000677041 Chr11:70973571..70973712 GTTGGAATTCCTTGCTGCTC Chr11:70973651..70973670 59.82 50
downstream ENSMUSE00000677035 Chr11:70972355..70972426 No primer for this exon
downstream ENSMUSE00000677040 Chr11:70970227..70970271 GCAGAGCAGGTCTGAGGTCT Chr11:70970229..70970248 59.74 60
downstream ENSMUSE00000677039 Chr11:70969497..70969794 AAGAGGTCCATGACCAGGTG Chr11:70969514..70969533 59.96 55
downstream ENSMUSE00000677038 Chr11:70966604..70967037 TCCATCCCTCAATTTTCTGG Chr11:70966895..70966914 59.86 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AATACCATAATCGCCTTGCAG Chr11:70987302..70987323 59.11 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TACCCCGTGACTGGGAAAAC Chr11:70996301..70996321 62.06 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000070390