Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38
Trapped Gene
Hspbap1 (ENSMUSG00000022849)
Vector Insertion
Chr 16: 35770626 - 35787275
Public Clones GC0286 (tigem) (sanger) (sanger) (sanger) SYA207 (baygenomics) CSH001 (baygenomics)
P145B10 (ggtc) P093H01 (ggtc) D093H04 (ggtc) (ggtc) D048B04 (ggtc)
P145B10 (ggtc) D052D06 (ggtc) (ggtc) A037B01 (ggtc) P065D06 (ggtc)
E025H02 (ggtc) (ggtc) P128E09 (ggtc) P110H02 (ggtc) D078C04 (ggtc)
(ggtc) D008H11 (ggtc) P093H01 (ggtc) D042A07 (ggtc) (ggtc)
P055D10 (ggtc) P079C11 (ggtc) E021A03 (ggtc) 3SE142B03 (ggtc) D042A07 (ggtc)
P145B10 (ggtc) D053H07 (ggtc) (ggtc) D052D06 (ggtc) P090E10 (ggtc)
P093H01 (ggtc) D008H11 (ggtc) (ggtc) IST14982E8 (tigm)
Private Clones OST445747 (lexicon) OST208338 (lexicon) OST40194 (lexicon)
Severity of mutation (?) Insertion after 5% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000394995 (Chr16:35770472..35770625 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGGATCCTTCCTGTGTGGA Chr16:35770482..35770501 60.05 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000394995 (Chr16:35770472..35770625 +)
Downstram Exon
ENSMUSE00000516388 (Chr16:35787276..35787461 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGGATCCTTCCTGTGTGGA Chr16:35770482..35770501 60.05 55 AAGGTGTTTCGCAGTCCAGT Chr16:35787403..35787422 59.77 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000394995 Chr16:35770472..35770625 GAGGATCCTTCCTGTGTGGA Chr16:35770482..35770501 60.05 55

*** Putative Vector Insertion (Chr 16: 35770626 - 35787275) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000516388 Chr16:35787276..35787461 AAGGTGTTTCGCAGTCCAGT Chr16:35787403..35787422 59.77 50
downstream ENSMUSE00000131275 Chr16:35801623..35801804 TCAGCGTAAGCCCAGAATTT Chr16:35801758..35801777 59.85 45
downstream ENSMUSE00000131273 Chr16:35814004..35814140 ACCCAAAGTCAGACCACACC Chr16:35814031..35814050 59.86 55
downstream ENSMUSE00000325705 Chr16:35817238..35817409 GAACTGGGGGAAACACTTCA Chr16:35817370..35817389 59.94 50
downstream ENSMUSE00000131261 Chr16:35818765..35818848 TGACGGTGACAGGATCAAGA Chr16:35818828..35818847 60.25 50
downstream ENSMUSE00000131271 Chr16:35824775..35824885 No primer for this exon
downstream ENSMUSE00000386605 Chr16:35824969..35828532 TTTGGCTACTGAGCGATGTG Chr16:35826611..35826630 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTGTGGGGGAGGAAGGTAG Chr16:35785611..35785631 60.36 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACTGTGGGGGAGGAAGGTAG Chr16:35785611..35785631 60.36 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022849