Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38000
Trapped Gene
Iqgap3 (ENSMUSG00000028068)
Vector Insertion
Chr 3: 87887941 - 87890071
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000516376 (Chr3:87887853..87887940 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATGAGCAGAGGCGACAGAAT Chr3:87887880..87887899 59.98 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000516376 (Chr3:87887853..87887940 +)
Downstram Exon
ENSMUSE00000469881 (Chr3:87890072..87890228 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATGAGCAGAGGCGACAGAAT Chr3:87887880..87887899 59.98 50 AAGCTCCTCCTTCAAGCACA Chr3:87890105..87890124 60.13 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000462841 Chr3:87885973..87886014 No primer for this exon
upstream ENSMUSE00000516376 Chr3:87887853..87887940 ATGAGCAGAGGCGACAGAAT Chr3:87887880..87887899 59.98 50

*** Putative Vector Insertion (Chr 3: 87887941 - 87890071) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000469881 Chr3:87890072..87890228 AAGCTCCTCCTTCAAGCACA Chr3:87890105..87890124 60.13 50
downstream ENSMUSE00000589832 Chr3:87891200..87891277 CTACCGCAGAGAGCCAAAAG Chr3:87891260..87891279 60.15 55
downstream ENSMUSE00000589831 Chr3:87892816..87892892 GTAGATCACCCGAGGCATGT Chr3:87892878..87892897 59.96 55
downstream ENSMUSE00000589830 Chr3:87893583..87893650 ATGGATCTGTGGAGCCAATC Chr3:87893625..87893644 59.89 50
downstream ENSMUSE00000589829 Chr3:87893739..87893852 ATCGGCTGAAAACTCATTGG Chr3:87893845..87893864 60.07 45
downstream ENSMUSE00000567192 Chr3:87894060..87894238 TGCCAGAGGTTCTCGAAGAT Chr3:87894178..87894197 59.95 50
downstream ENSMUSE00000589828 Chr3:87894658..87894736 GATGTCCTGCTCCTGACCAT Chr3:87894684..87894703 60.08 55
downstream ENSMUSE00000589827 Chr3:87895393..87895556 TCGTCAACAACTTCCAGTGC Chr3:87895423..87895442 59.88 50
downstream ENSMUSE00000589826 Chr3:87896334..87896421 GCCTGGATCTCCTCCTTTTC Chr3:87896380..87896399 60.15 55
downstream ENSMUSE00000589825 Chr3:87898506..87898669 ATGAGCTCCTTCACGGTGTC Chr3:87898581..87898600 60.27 55
downstream ENSMUSE00000589824 Chr3:87900824..87900981 GTCCCAAAAGGCACAGACAT Chr3:87900928..87900947 59.97 50
downstream ENSMUSE00000175724 Chr3:87902240..87902361 CTTCACCAGGGCATCAAAGT Chr3:87902264..87902283 60.11 50
downstream ENSMUSE00000402796 Chr3:87902779..87902942 ATGGTACCGAGGTGCAACAT Chr3:87902909..87902928 60.26 50
downstream ENSMUSE00000175722 Chr3:87904548..87904638 CTTGTGTCCTCGTTGGCTCT Chr3:87904627..87904646 60.44 55
downstream ENSMUSE00000175726 Chr3:87905350..87905517 TCCTCAACACACGCTCTGTC Chr3:87905427..87905446 60.03 55
downstream ENSMUSE00000175736 Chr3:87905600..87905739 CAAGTCCCCTGAAAGGTCTG Chr3:87905684..87905703 59.69 55
downstream ENSMUSE00000175721 Chr3:87905819..87905989 AAACTTCTGGCGAACAAGGA Chr3:87905938..87905957 59.85 45
downstream ENSMUSE00000175751 Chr3:87907982..87908065 GTCTATAACCCCGCCAGTGA Chr3:87908006..87908025 59.96 55
downstream ENSMUSE00000294182 Chr3:87908223..87908294 TTCTGGAAGTATCGCAGACG Chr3:87908293..87908312 59.02 50
downstream ENSMUSE00000175712 Chr3:87908388..87908457 TAGTCATCACGGGCTTTCCT Chr3:87908449..87908468 59.69 50
downstream ENSMUSE00000413406 Chr3:87911434..87911642 TGCTGGTTAGAGCGGATCTT Chr3:87911575..87911594 59.98 50
downstream ENSMUSE00000175744 Chr3:87912283..87912435 TTGGTCAGCTTCTTGCAGTG Chr3:87912317..87912336 60.17 50
downstream ENSMUSE00000567198 Chr3:87912729..87912892 GACGGTTGGAGGCATAGTTG Chr3:87912840..87912859 60.52 55
downstream ENSMUSE00000175745 Chr3:87913194..87913418 CCATTGCGGTAGAACCTCAC Chr3:87913277..87913296 60.52 55
downstream ENSMUSE00000396089 Chr3:87913917..87914057 GCGCAGGGAGATGTCTAATC Chr3:87913998..87914017 59.8 55
downstream ENSMUSE00000589811 Chr3:87916226..87916310 GGCATTGGGGAACTTCTTCT Chr3:87916292..87916311 60.44 50
downstream ENSMUSE00000387045 Chr3:87916520..87916752 GTACAGGAGGTTCCCAACCA Chr3:87916543..87916562 59.82 55
downstream ENSMUSE00000332890 Chr3:87917022..87917154 GTATTCATCGATGGCGAAGC Chr3:87917088..87917107 60.58 50
downstream ENSMUSE00000386665 Chr3:87917269..87917371 TTCTAGGAGCTGGTGCAGTG Chr3:87917337..87917356 59.19 55
downstream ENSMUSE00000589822 Chr3:87917846..87917972 TGTGGTCAGCATCTGTCTCC Chr3:87917950..87917969 59.83 55
downstream ENSMUSE00000476100 Chr3:87918826..87918913 AGGGTGGAACTGGATGAGGT Chr3:87918868..87918887 60.77 55
downstream ENSMUSE00000407129 Chr3:87919826..87920038 GGCCAGCTCGTCTACAAGTC Chr3:87920038..87920057 60.02 60
downstream ENSMUSE00000487103 Chr3:87920702..87920868 AGGCCTGGATGTATTGGTTG Chr3:87920843..87920862 59.81 50
downstream ENSMUSE00000589821 Chr3:87921121..87921222 TTCTTCCCCTTCCCAGAACT Chr3:87921144..87921163 60.04 50
downstream ENSMUSE00000349037 Chr3:87921598..87921706 GGCATTGACGAAAAACCTTC Chr3:87921664..87921683 59.55 45
downstream ENSMUSE00000513088 Chr3:87924085..87924970 ACCATGGTTCTTTGCAGGAC Chr3:87924428..87924447 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCAGAGTAATCGCCTTGCAG Chr3:87887986..87888006 60.92 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCAGGGTCCACTTCTCCTA Chr3:87887945..87887965 58.89 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028068