Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38005
Trapped Gene
Smcr7l (ENSMUSG00000022412)
Vector Insertion
Chr 15: 80066584 - 80077166
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000425826 (Chr15:80066235..80066583 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGTGTCTGTACCGGGCTCT Chr15:80066292..80066311 60.32 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000425826 (Chr15:80066235..80066583 +)
Downstram Exon
ENSMUSE00000126301 (Chr15:80077167..80077317 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGTGTCTGTACCGGGCTCT Chr15:80066292..80066311 60.32 60 GGAGAGCACAAAATCGATGG Chr15:80077251..80077270 60.6 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000622780 Chr15:80064550..80064611 AGAGAGGTACTGGGCGAGTG Chr15:80064557..80064576 59.47 60
upstream ENSMUSE00000425826 Chr15:80066235..80066583 CTGTGTCTGTACCGGGCTCT Chr15:80066292..80066311 60.32 60

*** Putative Vector Insertion (Chr 15: 80066584 - 80077166) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000126301 Chr15:80077167..80077317 GGAGAGCACAAAATCGATGG Chr15:80077251..80077270 60.6 50
downstream ENSMUSE00000126304 Chr15:80078304..80078481 CCTTGTTCAATAGGCGAGGA Chr15:80078418..80078437 60.21 50
downstream ENSMUSE00000126302 Chr15:80078671..80078933 ATGTCCCGAAGTGGCATATC Chr15:80078902..80078921 59.78 50
downstream ENSMUSE00000391931 Chr15:80079759..80083154 AGGAGTCAAGTGAGGGAGCA Chr15:80081699..80081718 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGGGGAGGGACTAATGGTAA Chr15:80075617..80075638 60.19 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTAATGGCGTGACTGGGAAA Chr15:80075628..80075648 61.02 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022412