Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38006
Trapped Gene
Scn8a (ENSMUSG00000023033)
Vector Insertion
Chr 15: 100814507 - 100832491
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 52% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000678475 (Chr15:100814120..100814506 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGCAAAAGCAGCATCTTCA Chr15:100814164..100814183 60.28 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000678475 (Chr15:100814120..100814506 +)
Downstram Exon
ENSMUSE00000678472 (Chr15:100832492..100832597 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGCAAAAGCAGCATCTTCA Chr15:100814164..100814183 60.28 45 TAGGAGGCGAGTTGTTCCAT Chr15:100832541..100832560 59.69 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000678477 Chr15:100701114..100701174 No primer for this exon
upstream ENSMUSE00000620823 Chr15:100766702..100767031 CTGGAGGACTTTGACCCGTA Chr15:100766996..100767015 60.1 55
upstream ENSMUSE00000620822 Chr15:100770555..100770587 No primer for this exon
upstream ENSMUSE00000132920 Chr15:100785841..100785961 TCAGATTTAGCGCCACTCCT Chr15:100785875..100785894 59.98 50
upstream ENSMUSE00000620821 Chr15:100787462..100787549 AGTAACCCTCCCGAATGGTC Chr15:100787518..100787537 60.19 55
upstream ENSMUSE00000620820 Chr15:100787892..100788020 GAGACCCGTGGAACTGGTTA Chr15:100787978..100787997 59.97 55
upstream ENSMUSE00000678474 Chr15:100789771..100789862 CAGGGTACTGAGGGCTTTGA Chr15:100789822..100789841 60.25 55
upstream ENSMUSE00000620819 Chr15:100790034..100790125 AGGGTTCTCCGAGCTTTGAA Chr15:100790086..100790105 61.26 50
upstream ENSMUSE00000398669 Chr15:100799452..100799673 GTCGTGTGGCCCATAAACTT Chr15:100799589..100799608 59.86 50
upstream ENSMUSE00000389831 Chr15:100800635..100800698 CTGGCATGCTAGAACCCTTG Chr15:100800653..100800672 60.79 55
upstream ENSMUSE00000549968 Chr15:100801951..100802092 ACACCAGCTTCGACACCTTC Chr15:100802007..100802026 60.31 55
upstream ENSMUSE00000549966 Chr15:100803185..100803391 GAGCAGAACCAGGCAACACT Chr15:100803296..100803315 60.45 55
upstream ENSMUSE00000678473 Chr15:100803185..100803331 TGGTGATCTTCGTGGGTTCT Chr15:100803228..100803247 60.51 50
upstream ENSMUSE00000132910 Chr15:100804854..100805147 GAAGATGGGGTAGGCTCTCC Chr15:100804914..100804933 60.04 60
upstream ENSMUSE00000290299 Chr15:100814120..100814476 AGAACGAGTTCGCAGACGAC Chr15:100814223..100814242 60.6 55
upstream ENSMUSE00000678475 Chr15:100814120..100814506 CAGCAAAAGCAGCATCTTCA Chr15:100814164..100814183 60.28 45

*** Putative Vector Insertion (Chr 15: 100814507 - 100832491) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000290294 Chr15:100832465..100832597 TAGGAGGCGAGTTGTTCCAT Chr15:100832541..100832560 59.69 50
downstream ENSMUSE00000678472 Chr15:100832492..100832597 TAGGAGGCGAGTTGTTCCAT Chr15:100832541..100832560 59.69 50
downstream ENSMUSE00000290407 Chr15:100838484..100838722 AAAGGGTCCATGACGATCAG Chr15:100838616..100838635 59.93 50
downstream ENSMUSE00000620818 Chr15:100841448..100841621 GCCCAGCTCCATTAAACTGA Chr15:100841579..100841598 60.21 50
downstream ENSMUSE00000620817 Chr15:100843670..100844026 ACCACGGCAAAGATGAAGAC Chr15:100843803..100843822 60.12 50
downstream ENSMUSE00000132918 Chr15:100846055..100846525 GGGTCTGACTCGCTGCTAAC Chr15:100846512..100846531 60.02 60
downstream ENSMUSE00000132912 Chr15:100846912..100847029 TCCACTGGGACTTCTTCCAC Chr15:100846988..100847007 60.09 55
downstream ENSMUSE00000549954 Chr15:100847472..100847626 CTCAAACCAATTGTGCTCCA Chr15:100847587..100847606 59.69 45
downstream ENSMUSE00000620816 Chr15:100848782..100848955 TGGTACGGATGGTCTTCCTC Chr15:100848830..100848849 59.93 55
downstream ENSMUSE00000678471 Chr15:100854270..100854299 No primer for this exon
downstream ENSMUSE00000620815 Chr15:100854692..100854814 GGCACCTAGTTCCGAGTAGC Chr15:100854748..100854767 58.96 60
downstream ENSMUSE00000491820 Chr15:100860009..100860293 TTCGAACCGGATTTCTGAAG Chr15:100860167..100860186 60.18 45
downstream ENSMUSE00000132902 Chr15:100862141..100862194 ATGTCCATCCAGCCTTTGAA Chr15:100862169..100862188 60.46 45
downstream ENSMUSE00000132916 Chr15:100862616..100862753 CGATGATGACACCGATGAAC Chr15:100862730..100862749 59.92 50
downstream ENSMUSE00000132913 Chr15:100863909..100864013 GGCTTCTTGGAGCCTAGCTT Chr15:100863991..100864010 60.12 55
downstream ENSMUSE00000620814 Chr15:100865866..100866136 CATGATCACGATGTCGAAGG Chr15:100865931..100865950 60.07 50
downstream ENSMUSE00000492772 Chr15:100869972..100876360 TTGGACAGAGCAGCAAAATG Chr15:100872139..100872158 59.99 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr15:100817492..100817512 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTTCATGCTCTGTGGATTGG Chr15:100817484..100817504 59.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023033