Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38007
Trapped Gene
Arid5b (ENSMUSG00000019947)
Vector Insertion
Chr 10: 67558340 - 67564842
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 40% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000099298 (Chr10:67564643..67564841 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000099298 (Chr10:67564643..67564841 -)
Downstram Exon
ENSMUSE00000575802 (Chr10:67558341..67561417 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000666206 Chr10:67741438..67741474 No primer for this exon
upstream ENSMUSE00000393468 Chr10:67740678..67740932 No primer for this exon
upstream ENSMUSE00000289228 Chr10:67705752..67705977 No primer for this exon
upstream ENSMUSE00000099301 Chr10:67648774..67649004 No primer for this exon
upstream ENSMUSE00000099314 Chr10:67597742..67597854 No primer for this exon
upstream ENSMUSE00000099312 Chr10:67591537..67591741 No primer for this exon
upstream ENSMUSE00000099319 Chr10:67589447..67589499 No primer for this exon
upstream ENSMUSE00000099321 Chr10:67580999..67581096 No primer for this exon
upstream ENSMUSE00000099298 Chr10:67564643..67564841 No primer for this exon
upstream ENSMUSE00000575802 Chr10:67558341..67561417 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GATGCCCGTCTTTTTCATCA Chr10:67558845..67558865 60.98 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GATGCCCGTCTTTTTCATCA Chr10:67558845..67558865 60.98 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000019947