Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38011
Trapped Gene
2610510H03Rik (ENSMUSG00000027349)
Vector Insertion
Chr 2: 117075575 - 117083369
Public Clones (sanger) (sanger) (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000168659 (Chr2:117075475..117075574 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAAGGGGACGTTCTGGACAC Chr2:117075540..117075559 61.89 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000168659 (Chr2:117075475..117075574 +)
Downstram Exon
ENSMUSE00000168662 (Chr2:117083370..117083515 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAAGGGGACGTTCTGGACAC Chr2:117075540..117075559 61.89 60 TGGAGAGTGCCTGTTCCTCT Chr2:117083410..117083429 59.99 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000168659 Chr2:117075475..117075574 GAAGGGGACGTTCTGGACAC Chr2:117075540..117075559 61.89 60

*** Putative Vector Insertion (Chr 2: 117075575 - 117083369) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000168662 Chr2:117083370..117083515 TGGAGAGTGCCTGTTCCTCT Chr2:117083410..117083429 59.99 55
downstream ENSMUSE00000168661 Chr2:117084957..117085091 CTTCTTTGTGAGGCGCTCTT Chr2:117085072..117085091 59.76 50
downstream ENSMUSE00000168660 Chr2:117085911..117086089 GGGCATCACATACAGCTTGA Chr2:117086030..117086049 59.68 50
downstream ENSMUSE00000418904 Chr2:117088575..117088655 CCCACATGGTTTTTCTGGAC Chr2:117088618..117088637 60.21 50
downstream ENSMUSE00000418899 Chr2:117089559..117089675 TTTGCTCTATCGGACCATCC Chr2:117089677..117089696 60.04 50
downstream ENSMUSE00000418893 Chr2:117093516..117093683 ATACCGCTGCTTGTCCTGAT Chr2:117093652..117093671 59.72 50
downstream ENSMUSE00000508232 Chr2:117096342..117097276 CTACCTCAGGGGGATGTTCA Chr2:117096826..117096845 59.92 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGGGGTGAGTGTTCTCGTG Chr2:117081571..117081591 61.74 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGGGGTGAGTGTTCTCGTG Chr2:117081571..117081591 61.74 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027349