Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38024
Trapped Gene
Zc3h12b (ENSMUSG00000035045)
Vector Insertion
Chr X: 92974309 - 93093603
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000697250 (ChrX:92974234..92974308 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATGCAACGTGACCAAATGTC ChrX:92974234..92974253 59.42 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000697250 (ChrX:92974234..92974308 +)
Downstram Exon
ENSMUSE00000697249 (ChrX:93093604..93093693 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATGCAACGTGACCAAATGTC ChrX:92974234..92974253 59.42 45 CCATAGGCAACAGAGGGAGA ChrX:93093628..93093647 60.21 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000697252 ChrX:92907017..92907485 GGCCTAGTATTCCGGGAGAG ChrX:92907204..92907223 60.05 60
upstream ENSMUSE00000697251 ChrX:92937244..92937310 CTGCTGAGCTGGACAGAGAG ChrX:92937281..92937300 59.02 60
upstream ENSMUSE00000697250 ChrX:92974234..92974308 ATGCAACGTGACCAAATGTC ChrX:92974234..92974253 59.42 45

*** Putative Vector Insertion (Chr X: 92974309 - 93093603) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000697249 ChrX:93093604..93093693 CCATAGGCAACAGAGGGAGA ChrX:93093628..93093647 60.21 55
downstream ENSMUSE00000712666 ChrX:93094279..93095039 CTCTCAGAGTTCGCCCATTC ChrX:93094571..93094590 59.95 55
downstream ENSMUSE00000716759 ChrX:93094279..93095039 CTCTCAGAGTTCGCCCATTC ChrX:93094571..93094590 59.95 55
downstream ENSMUSE00000549963 ChrX:93117692..93117831 GATTGCTCCTTTCTCCATGC ChrX:93117811..93117830 59.78 50
downstream ENSMUSE00000697243 ChrX:93117692..93117831 GATTGCTCCTTTCTCCATGC ChrX:93117811..93117830 59.78 50
downstream ENSMUSE00000654623 ChrX:93119784..93120018 CGATGGTGTGAAGACGAGAA ChrX:93119842..93119861 59.83 50
downstream ENSMUSE00000697247 ChrX:93120603..93120709 GATCATCTGGCGGCATAAAT ChrX:93120625..93120644 59.89 45
downstream ENSMUSE00000697244 ChrX:93121889..93123309 CATAACACGGTTGCATGAGG ChrX:93123070..93123089 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGGTGCTGGAGAGCAAAAC ChrX:92986270..92986290 59.48 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCTGGATACAGAAGCTTTCA ChrX:92986330..92986351 59.32 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035045