Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38043
Trapped Gene
Tbc1d13 (ENSMUSG00000039678)
Vector Insertion
Chr 2: 29992703 - 29992801
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 17% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000351402 (Chr2:29992641..29992702 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGAGAGAGCCTCGTGGACTT Chr2:29992664..29992683 60.93 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000351402 (Chr2:29992641..29992702 +)
Downstram Exon
ENSMUSE00000285767 (Chr2:29992802..29992901 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGAGAGAGCCTCGTGGACTT Chr2:29992664..29992683 60.93 60 AATGCCAGGCTGGATAATCA Chr2:29992853..29992872 60.44 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000646180 Chr2:29989310..29989432 AGTCCGGAAGTCAACACCAT Chr2:29989392..29989411 59.43 50
upstream ENSMUSE00000285790 Chr2:29990317..29990390 TGGAAAAGCTTCGAGAACTCA Chr2:29990361..29990381 60.12 42.86
upstream ENSMUSE00000285783 Chr2:29992193..29992233 No primer for this exon
upstream ENSMUSE00000351402 Chr2:29992641..29992702 GGAGAGAGCCTCGTGGACTT Chr2:29992664..29992683 60.93 60

*** Putative Vector Insertion (Chr 2: 29992703 - 29992801) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000285767 Chr2:29992802..29992901 AATGCCAGGCTGGATAATCA Chr2:29992853..29992872 60.44 45
downstream ENSMUSE00000285759 Chr2:29995995..29996077 GGAGTAGCACCTCGTTGTCC Chr2:29996061..29996080 59.73 60
downstream ENSMUSE00000285746 Chr2:29997782..29997941 TTCAGTGTCGTCTGCTCCAC Chr2:29997904..29997923 60.03 55
downstream ENSMUSE00000285707 Chr2:30002172..30002382 CAGGGTTGAGCTTGGCATAG Chr2:30002301..30002320 60.79 55
downstream ENSMUSE00000285697 Chr2:30002882..30003045 GATACCGCACTGGGAGTCAT Chr2:30002982..30003001 59.96 55
downstream ENSMUSE00000285737 Chr2:30004143..30004303 GGAGTCCCAGATACGGATGA Chr2:30004247..30004266 59.89 55
downstream ENSMUSE00000285726 Chr2:30004451..30004508 AGAAGCCGCATGTTGACAGT Chr2:30004507..30004526 60.87 50
downstream ENSMUSE00000370531 Chr2:30005220..30007529 AGGTACTGGGGATTCCTGCT Chr2:30006215..30006234 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGAGTGCCTAATCGCCTTG Chr2:29992745..29992765 60.8 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCAAGCAGAGGTGAGACCTA Chr2:29992694..29992714 58.03 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039678