Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38059
Trapped Gene
BC033915 (ENSMUSG00000034135)
Vector Insertion
Chr 9: 46006791 - 46010082
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 39% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000535588 (Chr9:46006635..46006790 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACAGCCGCCTACACTACAGC Chr9:46006649..46006668 60.48 60 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000535588 (Chr9:46006635..46006790 +)
Downstram Exon
ENSMUSE00000469567 (Chr9:46010083..46010153 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACAGCCGCCTACACTACAGC Chr9:46006649..46006668 60.48 60 TCCTCATCCACAGGGGTAAC Chr9:46010117..46010136 59.78 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000716228 Chr9:45820955..45821213 CGCATCGGCTACTACGAGAT Chr9:45821124..45821143 60.4 55
upstream ENSMUSE00000708962 Chr9:45821083..45821213 CGCATCGGCTACTACGAGAT Chr9:45821124..45821143 60.4 55
upstream ENSMUSE00000509505 Chr9:45821107..45821213 CGCATCGGCTACTACGAGAT Chr9:45821124..45821143 60.4 55
upstream ENSMUSE00000508466 Chr9:45931300..45931416 CCGGGAGGTTCAGATAATGA Chr9:45931359..45931378 59.89 50
upstream ENSMUSE00000251521 Chr9:45935093..45935156 GCTAGCGGAGGGGAGATATT Chr9:45935135..45935154 59.67 55
upstream ENSMUSE00000251500 Chr9:45963462..45963623 AAGCTCGACGGAAGTTCAAA Chr9:45963498..45963517 59.99 45
upstream ENSMUSE00000216314 Chr9:45985955..45986079 AGAGCTCTTCGAAGGGAAGG Chr9:45986031..45986050 60.09 55
upstream ENSMUSE00000216320 Chr9:45986515..45986638 CGCATCCCGTTCTTTATGTC Chr9:45986614..45986633 60.47 50
upstream ENSMUSE00000535595 Chr9:46002246..46002364 AAGTGGATGAAGCTCGGAGA Chr9:46002323..46002342 59.95 50
upstream ENSMUSE00000535593 Chr9:46002903..46003013 AGTGCCAGCAACTGAAGGAG Chr9:46002913..46002932 60.59 55
upstream ENSMUSE00000535592 Chr9:46003249..46003392 CTTTCCAGGCACCAGTCAAT Chr9:46003367..46003386 60.11 50
upstream ENSMUSE00000473458 Chr9:46003876..46003953 GCTGATCAACCCAGAGAACC Chr9:46003923..46003942 59.66 55
upstream ENSMUSE00000472651 Chr9:46004067..46004176 TTTGTCAATGAGGAGGCACA Chr9:46004135..46004154 60.24 45
upstream ENSMUSE00000535589 Chr9:46006230..46006383 CATGAACTTCACGCACAACC Chr9:46006317..46006336 60.16 50
upstream ENSMUSE00000535588 Chr9:46006635..46006790 ACAGCCGCCTACACTACAGC Chr9:46006649..46006668 60.48 60

*** Putative Vector Insertion (Chr 9: 46006791 - 46010082) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000469567 Chr9:46010083..46010153 TCCTCATCCACAGGGGTAAC Chr9:46010117..46010136 59.78 55
downstream ENSMUSE00000468488 Chr9:46012289..46012432 TGCCTTTTGGACCTATTTGC Chr9:46012318..46012337 60.07 45
downstream ENSMUSE00000471583 Chr9:46016005..46016155 GAGATGCAGGGTGTTGGAGT Chr9:46016041..46016060 60.12 55
downstream ENSMUSE00000462543 Chr9:46016801..46016926 CTGCTGGAGGATCTGATGGT Chr9:46016920..46016939 60.22 55
downstream ENSMUSE00000465486 Chr9:46017147..46017232 GTTGGTTTTCACAGGCAACC Chr9:46017207..46017226 60.4 50
downstream ENSMUSE00000467470 Chr9:46017638..46017747 GAGACGTGATCATGGCACTG Chr9:46017747..46017766 60.28 55
downstream ENSMUSE00000466468 Chr9:46018559..46018898 CCCAGGCAGGTTAGTGCTAC Chr9:46018670..46018689 59.76 60
downstream ENSMUSE00000535584 Chr9:46019753..46020645 ACTGGTCCGAAAACAGATGG Chr9:46019829..46019848 59.97 50
downstream ENSMUSE00000710331 Chr9:46019933..46020645 TGTTGCTGCCTTTTGATGAG Chr9:46020136..46020155 59.99 45
downstream ENSMUSE00000535583 Chr9:46027509..46027672 ATAGGCATCGTCGCTGTTCT Chr9:46027675..46027694 59.87 50
downstream ENSMUSE00000535581 Chr9:46028293..46028425 CATTCCTGGCAAGGTATCCA Chr9:46028322..46028341 60.85 50
downstream ENSMUSE00000535577 Chr9:46029150..46029317 CGTAGCTGGATAGCGAGAGG Chr9:46029235..46029254 60.13 60
downstream ENSMUSE00000484973 Chr9:46030152..46032269 TAGCCACTGCCTATGTGCTG Chr9:46031406..46031425 60.03 55
downstream ENSMUSE00000713173 Chr9:46030152..46030358 CCTTGGTGCCTTGGTCATAC Chr9:46030348..46030367 60.38 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCACTTGTCACCATGACACC Chr9:46006771..46006791 59.85 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCACTTGTCACCATGACACC Chr9:46006771..46006791 59.85 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034135