Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38109
Trapped Gene
Clec4a2 (ENSMUSG00000030148)
Vector Insertion
Chr 6: 123075105 - 123077969
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 28% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000507826 (Chr6:123074988..123075104 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTCCCCCTCACTGCTTCTTA Chr6:123075028..123075047 59.81 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000507826 (Chr6:123074988..123075104 +)
Downstram Exon
ENSMUSE00000510782 (Chr6:123077970..123078071 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTCCCCCTCACTGCTTCTTA Chr6:123075028..123075047 59.81 50 TTCCATGGGTGAAACACTTTT Chr6:123078072..123078092 59.32 38.1

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000512728 Chr6:123073410..123073687 GCTCTCTTCTGACGGAGGAA Chr6:123073572..123073591 59.68 55
upstream ENSMUSE00000507826 Chr6:123074988..123075104 TTCCCCCTCACTGCTTCTTA Chr6:123075028..123075047 59.81 50

*** Putative Vector Insertion (Chr 6: 123075105 - 123077969) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000510782 Chr6:123077970..123078071 TTCCATGGGTGAAACACTTTT Chr6:123078072..123078092 59.32 38.1
downstream ENSMUSE00000282960 Chr6:123089075..123089146 TCTAATGTCAGGGCCCTTTG Chr6:123089111..123089130 60.07 50
downstream ENSMUSE00000513700 Chr6:123089269..123089426 CACTAGATGAGCACCCATGC Chr6:123089405..123089424 59.27 55
downstream ENSMUSE00000552492 Chr6:123090674..123090786 TGTCCAAGATCCCAGTGATG Chr6:123090701..123090720 59.47 50
downstream ENSMUSE00000517673 Chr6:123092381..123094017 TAGCTGGGAATGCTGCTTTT Chr6:123093397..123093416 59.98 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr6:123075155..123075175 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCTACTTCTCCTGCTGCTG Chr6:123075058..123075078 59.49 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030148