Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38126
Trapped Gene
Abhd6 (ENSMUSG00000025277)
Vector Insertion
Chr 14: 8835478 - 8860750
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000350253 (Chr14:8835457..8835477 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000350253 (Chr14:8835457..8835477 +)
Downstram Exon
ENSMUSE00000390530 (Chr14:8860751..8860903 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TTGAGCCTTGTTGACACCTG Chr14:8860779..8860798 59.87 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000350253 Chr14:8835457..8835477 No primer for this exon

*** Putative Vector Insertion (Chr 14: 8835478 - 8860750) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000390530 Chr14:8860751..8860903 TTGAGCCTTGTTGACACCTG Chr14:8860779..8860798 59.87 50
downstream ENSMUSE00000306381 Chr14:8872262..8872418 GTCCTTGTGTGCGGAGAATC Chr14:8872400..8872419 60.67 55
downstream ENSMUSE00000149485 Chr14:8873633..8873746 ACTTGCCCCACTATGGACAG Chr14:8873733..8873752 59.99 55
downstream ENSMUSE00000149483 Chr14:8875208..8875340 AGCAGGACACACGAGAGACA Chr14:8875342..8875361 59.6 55
downstream ENSMUSE00000149487 Chr14:8877982..8878139 CCTTGAAGCGGACATAGGAG Chr14:8878131..8878150 59.83 55
downstream ENSMUSE00000149484 Chr14:8882088..8882142 GAATGCGAACATCGACAAGA Chr14:8882121..8882140 59.81 45
downstream ENSMUSE00000149480 Chr14:8882322..8882422 CTGTGTCGGGACCTTGATCT Chr14:8882401..8882420 60.11 55
downstream ENSMUSE00000149481 Chr14:8887985..8888423 CTACCGAATGGCCACAGTTT Chr14:8888075..8888094 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTGAAGTGTGTCATTGCTCA Chr14:8856459..8856480 59.89 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTGGTCTTTTCGTGACTGG Chr14:8856518..8856538 60.83 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025277