Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3813
Trapped Gene
2810026P18Rik (ENSMUSG00000032424)
Vector Insertion
Chr 9: 88416287 - 88416487
Public Clones AN1025 (sanger) CD0023 (sanger)
Private Clones OST265271 (lexicon) OST241310 (lexicon) OST173714 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000219687 (Chr9:88416488..88416554 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AACTTGCGAGAGATGCCAGT Chr9:88416520..88416539 60.02 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000219687 (Chr9:88416488..88416554 -)
Downstram Exon
ENSMUSE00000233255 (Chr9:88415893..88416286 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AACTTGCGAGAGATGCCAGT Chr9:88416520..88416539 60.02 50 TTCATTCGCACGTCTTGTGT Chr9:88416237..88416256 60.31 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000219688 Chr9:88417322..88417711 ATTCGTACTAAGCGGCCTGA Chr9:88417512..88417531 59.87 50
upstream ENSMUSE00000219686 Chr9:88417145..88417219 GAGCCCAAAGCATCTGAGAG Chr9:88417192..88417211 60.1 55
upstream ENSMUSE00000219689 Chr9:88416756..88416813 TGAATGCTGACCAGTGAGATG Chr9:88416793..88416813 59.85 47.62
upstream ENSMUSE00000219687 Chr9:88416488..88416554 AACTTGCGAGAGATGCCAGT Chr9:88416520..88416539 60.02 50

*** Putative Vector Insertion (Chr 9: 88416287 - 88416487) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000233255 Chr9:88415893..88416286 TTCATTCGCACGTCTTGTGT Chr9:88416237..88416256 60.31 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr9:88416416..88416436 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000032424