Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38139
Trapped Gene
Rps27a (ENSMUSG00000020460)
Vector Insertion
Chr 11: 29446290 - 29446789
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 41% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000104963 (Chr11:29446703..29446788 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000104963 (Chr11:29446703..29446788 -)
Downstram Exon
ENSMUSE00000483002 (Chr11:29446291..29446422 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000662791 Chr11:29447841..29447861 No primer for this exon
upstream ENSMUSE00000662788 Chr11:29447681..29447860 No primer for this exon
upstream ENSMUSE00000662790 Chr11:29447681..29447745 No primer for this exon
upstream ENSMUSE00000104962 Chr11:29447206..29447260 No primer for this exon
upstream ENSMUSE00000104963 Chr11:29446703..29446788 No primer for this exon
upstream ENSMUSE00000483002 Chr11:29446291..29446422 No primer for this exon

*** Putative Vector Insertion (Chr 11: 29446290 - 29446789) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000706131 Chr11:29445847..29446029 No primer for this exon
downstream ENSMUSE00000706132 Chr11:29445846..29446029 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCAGCAGAGGCTGATCTTTG Chr11:29446754..29446774 59.27 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCAGCAGAGGCTGATCTTTG Chr11:29446754..29446774 59.27 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020460