Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38165
Trapped Gene
Nbeal2 (ENSMUSG00000056724)
Vector Insertion
Chr 9: 110535480 - 110536702
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 52% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000583138 (Chr9:110536186..110536701 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTTCTACCAGGCCCTCTCC Chr9:110536441..110536460 60.2 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000583138 (Chr9:110536186..110536701 -)
Downstram Exon
ENSMUSE00000306140 (Chr9:110535481..110535659 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTTCTACCAGGCCCTCTCC Chr9:110536441..110536460 60.2 60 TGGGTAAGCACGGAGAAGAC Chr9:110535510..110535529 60.26 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000583165 Chr9:110556401..110556469 TCTACGAGTTGTGGCTGCTC Chr9:110556413..110556432 59.19 55
upstream ENSMUSE00000583164 Chr9:110547134..110547222 TCTCGTTATCCTCCCTGGAA Chr9:110547142..110547161 59.62 50
upstream ENSMUSE00000583163 Chr9:110546921..110547049 TACATGCACTAGCGGAGCAG Chr9:110546983..110547002 60.18 55
upstream ENSMUSE00000583162 Chr9:110546724..110546805 AGAACGTAGAGGCTGGTTGG Chr9:110546778..110546797 59.35 55
upstream ENSMUSE00000583161 Chr9:110546513..110546631 GGACCCAGCTAGAGAACGTG Chr9:110546584..110546603 59.87 60
upstream ENSMUSE00000583160 Chr9:110546216..110546298 GGAAGTCATCAGCTCCAAGG Chr9:110546279..110546298 59.8 55
upstream ENSMUSE00000583159 Chr9:110544889..110544974 ACCTCTTTGGTGCCATCCTT Chr9:110544901..110544920 60.88 50
upstream ENSMUSE00000583158 Chr9:110544515..110544797 AACTGCGTACCCTGCTTGAG Chr9:110544606..110544625 60.45 55
upstream ENSMUSE00000583157 Chr9:110544275..110544381 ATTCGCCTCATCCAGAACAG Chr9:110544279..110544298 60.22 50
upstream ENSMUSE00000633990 Chr9:110543915..110543995 TACTGACTGAGCCCGATGTC Chr9:110543921..110543940 58.83 55
upstream ENSMUSE00000583156 Chr9:110542284..110542367 GTCAGAGTGCTGACCTGCAT Chr9:110542309..110542328 59 55
upstream ENSMUSE00000583155 Chr9:110541798..110541896 ACAGGCTGTTGCAGGAATTG Chr9:110541807..110541826 61.24 50
upstream ENSMUSE00000583136 Chr9:110540809..110541410 ACACTTAACACGGGGACAGC Chr9:110541187..110541206 60.03 55
upstream ENSMUSE00000583152 Chr9:110540596..110540728 CACACGGAAGGAGTACGTGA Chr9:110540637..110540656 59.74 55
upstream ENSMUSE00000583151 Chr9:110540383..110540502 GGCCATCTGGTCAAGACAGT Chr9:110540411..110540430 60.12 55
upstream ENSMUSE00000583150 Chr9:110539868..110540189 ATCTGCCCTAAGGGTCCTGT Chr9:110539877..110539896 59.96 55
upstream ENSMUSE00000583149 Chr9:110539579..110539661 AGTTTGGCACCAAGTTGCTC Chr9:110539597..110539616 60.3 50
upstream ENSMUSE00000583148 Chr9:110539395..110539487 GGCCGTCTGACAGGACATAG Chr9:110539417..110539436 60.68 60
upstream ENSMUSE00000583147 Chr9:110539066..110539240 ACCTCGTAGGACCTGAGCTG Chr9:110539118..110539137 59.47 60
upstream ENSMUSE00000583146 Chr9:110538799..110538932 ACACCGTGAATCAGGAGAGC Chr9:110538847..110538866 60.27 55
upstream ENSMUSE00000583145 Chr9:110538365..110538524 AGTTCGGCCATGGATATGAA Chr9:110538499..110538518 60.3 45
upstream ENSMUSE00000583144 Chr9:110538118..110538220 TTCAGTTCCTCCTCGATGCT Chr9:110538135..110538154 59.95 50
upstream ENSMUSE00000583143 Chr9:110537802..110537955 GTCTGGTGCGTGAGTTCTTG Chr9:110537874..110537893 59.47 55
upstream ENSMUSE00000583142 Chr9:110537550..110537708 GAGCTGTTGCTAACCCTGCT Chr9:110537674..110537693 59.64 55
upstream ENSMUSE00000583141 Chr9:110537217..110537376 GCTTGTCGGAAGAGAGCATC Chr9:110537263..110537282 60.1 55
upstream ENSMUSE00000583139 Chr9:110536868..110536953 GACCTCAGTGTCCGCCTAGA Chr9:110536881..110536900 60.41 60
upstream ENSMUSE00000583138 Chr9:110536186..110536701 CTTTCTACCAGGCCCTCTCC Chr9:110536441..110536460 60.2 60
upstream ENSMUSE00000306140 Chr9:110535481..110535659 ACTTGTGCGACCACCAGACT Chr9:110535494..110535513 60.78 55

*** Putative Vector Insertion (Chr 9: 110535480 - 110536702) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000306115 Chr9:110535239..110535398 CGGTCAGGGCTGACTCTAAC Chr9:110535342..110535361 59.87 60
downstream ENSMUSE00000633989 Chr9:110534794..110534931 ATCAAGCAGGTTGCACACAC Chr9:110534880..110534899 59.76 50
downstream ENSMUSE00000633988 Chr9:110534362..110534706 TCAGTCTCGGAAGACGAGGT Chr9:110534545..110534564 59.99 55
downstream ENSMUSE00000306064 Chr9:110534124..110534273 CCAGAAGCCTGACATGAGGT Chr9:110534180..110534199 60.26 55
downstream ENSMUSE00000306038 Chr9:110533846..110534003 CTGCCTGCTGCTTCAGTACA Chr9:110533903..110533922 60.35 55
downstream ENSMUSE00000306016 Chr9:110533505..110533629 TTCCAGGTGAGGGTCAAAGT Chr9:110533508..110533527 59.55 50
downstream ENSMUSE00000305971 Chr9:110533288..110533423 GATTTTGGCCTCTTTGGTCA Chr9:110533334..110533353 60.05 45
downstream ENSMUSE00000305948 Chr9:110532694..110532857 ACAAGCTTCTCGCGTTTCTC Chr9:110532791..110532810 59.76 50
downstream ENSMUSE00000305936 Chr9:110532274..110532590 GCGCAGAAGCAATGAGTACA Chr9:110532327..110532346 60.17 50
downstream ENSMUSE00000306630 Chr9:110532074..110532169 CCTGCGATTGTGTTGAGTTG Chr9:110532086..110532105 60.3 50
downstream ENSMUSE00000306610 Chr9:110531620..110531744 GGATTGCTGAGGTCCAAGAC Chr9:110531670..110531689 59.66 55
downstream ENSMUSE00000529210 Chr9:110531382..110531522 CCCGCTGCGTTAGAATAGTG Chr9:110531426..110531445 60.78 55
downstream ENSMUSE00000529209 Chr9:110531123..110531253 TGGTTCTCCAGGAAGTCAGG Chr9:110531106..110531125 60.23 55
downstream ENSMUSE00000529207 Chr9:110530898..110531007 GCGGTGTTTCTGGATGAAAT Chr9:110530885..110530904 59.94 45
downstream ENSMUSE00000529206 Chr9:110530691..110530808 GATGAGGTCGATCCATTCGT Chr9:110530739..110530758 59.89 50
downstream ENSMUSE00000529205 Chr9:110530496..110530593 ACAAGGAGTCTGCCCGAAGT Chr9:110530486..110530505 61.22 55
downstream ENSMUSE00000529203 Chr9:110530311..110530427 AGCGAAAAAGGCCTTGAGTT Chr9:110530292..110530311 60.37 45
downstream ENSMUSE00000529200 Chr9:110529773..110529862 GTGTGACTGTCGGTGAGGAA Chr9:110529784..110529803 59.71 55
downstream ENSMUSE00000529198 Chr9:110529582..110529691 TTGATGTTCCGGTCATAGGG Chr9:110529605..110529624 60.71 50
downstream ENSMUSE00000529197 Chr9:110529237..110529409 GAAGAGCAGCTTTCCGTCAG Chr9:110529297..110529316 60.28 55
downstream ENSMUSE00000529196 Chr9:110529040..110529134 GGAGCCGGAGATGAGGTAGA Chr9:110529057..110529076 61.67 60
downstream ENSMUSE00000409400 Chr9:110528721..110528837 CACTGCAGCTACATGTCCGTA Chr9:110528750..110528770 59.94 52.38
downstream ENSMUSE00000306799 Chr9:110528467..110528625 TTAATGCTGCCACAAACTGG Chr9:110528549..110528568 59.73 45
downstream ENSMUSE00000306780 Chr9:110528238..110528386 CAGGTGCAAGGAGTAGGTGA Chr9:110528344..110528363 58.88 55
downstream ENSMUSE00000446506 Chr9:110527833..110527968 CAACGATCAATTTGCCATCTT Chr9:110527834..110527854 59.95 38.1
downstream ENSMUSE00000446500 Chr9:110527299..110527730 AGGCCACGTTTATTGCTGAG Chr9:110527285..110527304 60.27 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTTTGGCAGCTCTTTTACC Chr9:110536690..110536710 58.84 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTTTGGCAGCTCTTTTACC Chr9:110536690..110536710 58.84 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000056724