Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38173
Trapped Gene
Mill1 (ENSMUSG00000054005)
Vector Insertion
Chr 7: 18841322 - 18847787
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 15% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000599623 (Chr7:18841235..18841321 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000599623 (Chr7:18841235..18841321 +)
Downstram Exon
ENSMUSE00000406984 (Chr7:18847788..18848051 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000599624 Chr7:18830696..18831049 No primer for this exon
upstream ENSMUSE00000599623 Chr7:18841235..18841321 No primer for this exon

*** Putative Vector Insertion (Chr 7: 18841322 - 18847787) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000406984 Chr7:18847788..18848051 No primer for this exon
downstream ENSMUSE00000501612 Chr7:18848277..18848552 No primer for this exon
downstream ENSMUSE00000457577 Chr7:18849934..18851441 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTTTCTGCACTAATCGCCTTG Chr7:18844363..18844384 60.03 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACAGGCGGTAGCAGGTAAGT Chr7:18844309..18844329 58.89 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000054005