Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38179
Trapped Gene
100040531 (ENSMUSG00000079732)
Vector Insertion
Chr 17: 6603425 - 6606506
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 21% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000704104 (Chr17:6603383..6603424 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000704104 (Chr17:6603383..6603424 +)
Downstram Exon
ENSMUSE00000704103 (Chr17:6606507..6606630 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000704105 Chr17:6600835..6600961 No primer for this exon
upstream ENSMUSE00000704104 Chr17:6603383..6603424 No primer for this exon

*** Putative Vector Insertion (Chr 17: 6603425 - 6606506) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000704103 Chr17:6606507..6606630 No primer for this exon
downstream ENSMUSE00000704102 Chr17:6606969..6607046 No primer for this exon
downstream ENSMUSE00000704101 Chr17:6609607..6609656 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGATGAAGTGAGCAGCATTG Chr17:6606397..6606418 60 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGATGAAGTGAGCAGCATTG Chr17:6606397..6606418 60 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000079732