Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38183
Trapped Gene
Sorl1 (ENSMUSG00000049313)
Vector Insertion
Chr 9: 41784440 - 41785694
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 91% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000454006 (Chr9:41785519..41785693 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACAAAGTCAGATCCCGCAAC Chr9:41785625..41785644 60.12 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000454006 (Chr9:41785519..41785693 -)
Downstram Exon
ENSMUSE00000454002 (Chr9:41784441..41784547 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACAAAGTCAGATCCCGCAAC Chr9:41785625..41785644 60.12 50 AACGTGGTCGTTTTCCGTTA Chr9:41784473..41784492 60.4 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000454738 Chr9:41931912..41932372 CTTTCCTATTCGCCCTGGTC Chr9:41932140..41932159 60.95 55
upstream ENSMUSE00000454712 Chr9:41914511..41914627 CAACGTGATCGTGGCATTAG Chr9:41914552..41914571 60.13 50
upstream ENSMUSE00000454703 Chr9:41907228..41907353 ACAGCGAAGCTGTGATCTCC Chr9:41907261..41907280 60.56 55
upstream ENSMUSE00000454686 Chr9:41900392..41900553 ACAGGTCTCACCCCAACAAG Chr9:41900395..41900414 60 55
upstream ENSMUSE00000454679 Chr9:41898028..41898095 CAGATGATTTTGGCCAGACC Chr9:41898066..41898085 60.46 50
upstream ENSMUSE00000454673 Chr9:41889871..41890051 TTTCAGCTTCGCGACAAGTA Chr9:41889893..41889912 59.75 45
upstream ENSMUSE00000454658 Chr9:41880328..41880429 AGAGCAGCCCAGTTTGTCAC Chr9:41880344..41880363 60.45 55
upstream ENSMUSE00000454647 Chr9:41879155..41879324 AGGACCAGGTGTTCGTGTGT Chr9:41879280..41879299 60.48 55
upstream ENSMUSE00000454640 Chr9:41875880..41876072 TGCCACCCTGATTAATGGTT Chr9:41875990..41876009 60.19 45
upstream ENSMUSE00000454633 Chr9:41872070..41872187 CCGGTCTCATCATTGCTACC Chr9:41872071..41872090 60.48 55
upstream ENSMUSE00000454627 Chr9:41871798..41871871 GCCAGCAAGACCAATGTGTA Chr9:41871832..41871851 59.72 50
upstream ENSMUSE00000454622 Chr9:41865354..41865442 ATGGAGACCAACGAGCTGAA Chr9:41865354..41865373 60.8 50
upstream ENSMUSE00000454618 Chr9:41854566..41854744 GAGCACCGTCTTCACCATCT Chr9:41854632..41854651 60.27 55
upstream ENSMUSE00000454607 Chr9:41851990..41852176 CCAGTGGTTGTGTCCAACTG Chr9:41852017..41852036 60.04 55
upstream ENSMUSE00000454603 Chr9:41849647..41849775 CCTTGTCCTGTGGGTTCTTC Chr9:41849665..41849684 59.55 55
upstream ENSMUSE00000454597 Chr9:41849076..41849161 AGTGGAGGAGACGTTGAAGC Chr9:41849114..41849133 59.46 55
upstream ENSMUSE00000454594 Chr9:41845132..41845304 TGGCCCTGGACTTTGACTAT Chr9:41845180..41845199 59.55 50
upstream ENSMUSE00000454588 Chr9:41843526..41843657 GGCAGGAGGTGATCATCAAT Chr9:41843613..41843632 59.89 50
upstream ENSMUSE00000454582 Chr9:41841648..41841739 CCAGATGGTGACTTCCGACT Chr9:41841711..41841730 60.11 55
upstream ENSMUSE00000454578 Chr9:41839752..41839998 AGCAGCGTTCAGTCATCCTT Chr9:41839791..41839810 60.02 50
upstream ENSMUSE00000454567 Chr9:41838962..41839100 GGGATGACTGGTCACAGCTC Chr9:41839068..41839087 60.69 60
upstream ENSMUSE00000454562 Chr9:41832379..41832552 CTCCCTAAGGCCAACAACAG Chr9:41832492..41832511 59.73 55
upstream ENSMUSE00000454557 Chr9:41830419..41830532 GAACACCTGTCTCCGAAACC Chr9:41830512..41830531 59.56 55
upstream ENSMUSE00000454549 Chr9:41826199..41826321 GGACTTGCATTCCACTCTCC Chr9:41826254..41826273 59.66 55
upstream ENSMUSE00000454544 Chr9:41822538..41822657 GTGTCGTAGCGACGAGTTCA Chr9:41822628..41822647 60.06 55
upstream ENSMUSE00000454538 Chr9:41816262..41816387 CAACTTCCAGTGCCACAATG Chr9:41816343..41816362 60.15 50
upstream ENSMUSE00000454532 Chr9:41813889..41813996 GTCCAGCAAGCATTGTGATG Chr9:41813931..41813950 60.27 50
upstream ENSMUSE00000337086 Chr9:41812069..41812200 CGTGTGTAAGAACCGTCAGC Chr9:41812153..41812172 59.37 55
upstream ENSMUSE00000454522 Chr9:41810637..41810768 ACTCTGACGAGGCCAACTGT Chr9:41810638..41810657 59.91 55
upstream ENSMUSE00000276237 Chr9:41809554..41809688 CCCAAACTGTTCCCGTTACT Chr9:41809653..41809672 58.96 50
upstream ENSMUSE00000454510 Chr9:41808327..41808482 CTGTGCAGATGGCTCTGATG Chr9:41808348..41808367 60.58 55
upstream ENSMUSE00000454503 Chr9:41804254..41804403 CGACCGATTTGAGTTCGAGT Chr9:41804341..41804360 60.26 50
upstream ENSMUSE00000454495 Chr9:41800387..41800518 CACCTTGACCTGTACGAGCA Chr9:41800489..41800508 59.9 55
upstream ENSMUSE00000454491 Chr9:41799702..41799828 CCGGAGATGTGACTTTGACC Chr9:41799758..41799777 60.51 55
upstream ENSMUSE00000454485 Chr9:41799395..41799564 AACAAGGTGCACAACACCAA Chr9:41799427..41799446 60.05 45
upstream ENSMUSE00000474786 Chr9:41797437..41797549 GGCCTCATCCGTGAGTACAT Chr9:41797438..41797457 59.96 55
upstream ENSMUSE00000454043 Chr9:41796788..41796892 CAGGAGTGGGTCCAAGATGT Chr9:41796862..41796881 59.96 55
upstream ENSMUSE00000454037 Chr9:41795549..41795621 TCGTGGGATAGGAAACTGGA Chr9:41795585..41795604 60.45 50
upstream ENSMUSE00000454031 Chr9:41793641..41793723 CCAAGCACCAAATATCCACA Chr9:41793700..41793719 59.4 45
upstream ENSMUSE00000454026 Chr9:41792519..41792618 CGTGGTGAACCTTTTCTGGT Chr9:41792588..41792607 60.01 50
upstream ENSMUSE00000454020 Chr9:41790989..41791173 CCAAGGCCATCAATCAGACT Chr9:41791025..41791044 60.07 50
upstream ENSMUSE00000454015 Chr9:41788709..41788828 ACAGTCATCGTCAGCAAGGA Chr9:41788728..41788747 59.42 50
upstream ENSMUSE00000454011 Chr9:41787413..41787577 CGCCCTATGACTCTCCTGAC Chr9:41787422..41787441 59.83 60
upstream ENSMUSE00000454006 Chr9:41785519..41785693 ACAAAGTCAGATCCCGCAAC Chr9:41785625..41785644 60.12 50
upstream ENSMUSE00000454002 Chr9:41784441..41784547 CCACGTTCTCCTCTTTTGGA Chr9:41784482..41784501 60.22 50

*** Putative Vector Insertion (Chr 9: 41784440 - 41785694) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000453999 Chr9:41782020..41782212 CGAGGTAAGCGGTGAGATTC Chr9:41782139..41782158 59.84 55
downstream ENSMUSE00000453995 Chr9:41777727..41777939 CGGTGCTTCGTGTAGAGGAT Chr9:41777794..41777813 60.28 55
downstream ENSMUSE00000637669 Chr9:41776572..41776753 TGGGGACATCGTCTGAGAAT Chr9:41776678..41776697 60.47 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAAGACGGACAGAAGCTCGT Chr9:41785640..41785660 59.6 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000049313