Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38190
Trapped Gene
Rlbp1l2 (ENSMUSG00000019785)
Vector Insertion
Chr 10: 33315549 - 33342865
Public Clones (sanger) (sanger) (sanger) (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 40% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000098041 (Chr10:33342350..33342864 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTCATCACTAGGCCGGACAT Chr10:33342608..33342627 59.96 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000098041 (Chr10:33342350..33342864 -)
Downstram Exon
ENSMUSE00000317449 (Chr10:33315550..33315724 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTCATCACTAGGCCGGACAT Chr10:33342608..33342627 59.96 55 AGATGGCACGCAAAATATCC Chr10:33315671..33315690 59.93 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000437276 Chr10:33343942..33344575 TCCTCTCTCGAAGGCAAAAA Chr10:33344202..33344221 60.07 45
upstream ENSMUSE00000098041 Chr10:33342350..33342864 GTCATCACTAGGCCGGACAT Chr10:33342608..33342627 59.96 55
upstream ENSMUSE00000317449 Chr10:33315550..33315724 GGATATTTTGCGTGCCATCT Chr10:33315693..33315712 59.93 45

*** Putative Vector Insertion (Chr 10: 33315549 - 33342865) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000317442 Chr10:33263188..33263298 CTCTTTCAGGAATGGGCGTA Chr10:33263181..33263200 60.21 50
downstream ENSMUSE00000317434 Chr10:33248129..33248349 ATGTCATATGGGGGCAACAT Chr10:33248230..33248249 59.9 45
downstream ENSMUSE00000384859 Chr10:33232092..33233152 GAGACGATTTGCCATTTGGT Chr10:33232430..33232449 59.94 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGCTGTGAGTGCCTCATTT Chr10:33327877..33327897 59.04 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGCTGTGAGTGCCTCATTT Chr10:33321877..33321897 59.04 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000019785