Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38191
Trapped Gene
Has3 (ENSMUSG00000031910)
Vector Insertion
Chr 8: 109398447 - 109400791
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 38% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000214618 (Chr8:109397808..109398446 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTCTTTGTGTGGCGTAGCA Chr8:109398251..109398270 60.05 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000214618 (Chr8:109397808..109398446 +)
Downstram Exon
ENSMUSE00000214617 (Chr8:109400792..109400893 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTCTTTGTGTGGCGTAGCA Chr8:109398251..109398270 60.05 50 CCAAGACTCGAAGCATCTCA Chr8:109400855..109400874 59.11 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000679730 Chr8:109394142..109394314 CCTTGGCGTTCAGAAGATTT Chr8:109394273..109394292 59.31 45
upstream ENSMUSE00000214618 Chr8:109397808..109398446 CTTCTTTGTGTGGCGTAGCA Chr8:109398251..109398270 60.05 50

*** Putative Vector Insertion (Chr 8: 109398447 - 109400791) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000214617 Chr8:109400792..109400893 CCAAGACTCGAAGCATCTCA Chr8:109400855..109400874 59.11 50
downstream ENSMUSE00000634552 Chr8:109401805..109406802 GAGAATGCACTGCTGGTGAA Chr8:109406042..109406061 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGGCTGCCTCCCTTAGAGT Chr8:109398450..109398470 59.48 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGGCTGCCTCCCTTAGAGT Chr8:109398450..109398470 59.48 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031910