Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3821
Trapped Gene
Polr3b (ENSMUSG00000034453)
Vector Insertion
Chr 10: 84102596 - 84109540
Public Clones AZ0771 (sanger) CMHD-GT_328D10-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 21% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000426018 (Chr10:84102487..84102595 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGTGAAACAGGGTCGATTCTA Chr10:84102523..84102543 60.12 47.62 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000426018 (Chr10:84102487..84102595 +)
Downstram Exon
ENSMUSE00000337154 (Chr10:84109541..84109663 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGTGAAACAGGGTCGATTCTA Chr10:84102523..84102543 60.12 47.62 ATCTGCACGATTTCCTGGTC Chr10:84109581..84109600 60.08 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000403133 Chr10:84085182..84085283 ATGGATGTTCTAGCCGAGGA Chr10:84085212..84085231 59.65 50
upstream ENSMUSE00000367566 Chr10:84090995..84091027 AGGCTGCTTCCAGCATTTTT Chr10:84091004..84091023 61.25 45
upstream ENSMUSE00000292325 Chr10:84091228..84091284 TAAAGGCCTGGTGAAACAGC Chr10:84091230..84091249 60.25 50
upstream ENSMUSE00000292318 Chr10:84091372..84091436 GCTGACCCCATGTGGTACTT Chr10:84091414..84091433 59.85 55
upstream ENSMUSE00000292314 Chr10:84094530..84094605 TGTCGGACTTCCTGATGTTG Chr10:84094545..84094564 59.68 50
upstream ENSMUSE00000292306 Chr10:84095200..84095300 CGTCTGAGGGACATGACGTA Chr10:84095203..84095222 59.7 55
upstream ENSMUSE00000292301 Chr10:84097646..84097737 CTCCGAAGCTCGAACTGTGT Chr10:84097659..84097678 60.59 55
upstream ENSMUSE00000379048 Chr10:84100800..84100917 CAAGAGCAGCTGTCCAAGAA Chr10:84100844..84100863 59.31 50
upstream ENSMUSE00000426018 Chr10:84102487..84102595 CGTGAAACAGGGTCGATTCTA Chr10:84102523..84102543 60.12 47.62

*** Putative Vector Insertion (Chr 10: 84102596 - 84109540) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000337154 Chr10:84109541..84109663 ATCTGCACGATTTCCTGGTC Chr10:84109581..84109600 60.08 50
downstream ENSMUSE00000385772 Chr10:84115419..84115538 GGTACGTGGGTCAGAATGGT Chr10:84115540..84115559 59.7 55
downstream ENSMUSE00000291829 Chr10:84118690..84118824 GCCAATTCCAGTCGTTTGTT Chr10:84118820..84118839 59.98 45
downstream ENSMUSE00000291825 Chr10:84130067..84130228 GACCATGCCGTTGGTAATCT Chr10:84130216..84130235 59.82 50
downstream ENSMUSE00000291819 Chr10:84136073..84136273 CCCTGTCGGTCCATCTTAAA Chr10:84136116..84136135 59.93 50
downstream ENSMUSE00000291813 Chr10:84137302..84137464 ATGGGTCCATCTTCCATGTC Chr10:84137372..84137391 59.59 50
downstream ENSMUSE00000480684 Chr10:84139628..84139781 CACAGCGATCCGTAAGGTTT Chr10:84139750..84139769 60.13 50
downstream ENSMUSE00000484247 Chr10:84142491..84142565 TTTGTGACAGCTGGCTTTTG Chr10:84142535..84142554 60.03 45
downstream ENSMUSE00000483377 Chr10:84143111..84143209 TGTTCGTAGAGCGCAATGTT Chr10:84143200..84143219 59.49 45
downstream ENSMUSE00000516313 Chr10:84146922..84147049 CCAAGCAGAGTGAAGGGTTC Chr10:84146966..84146985 59.84 55
downstream ENSMUSE00000514118 Chr10:84155542..84155751 CCAGAGAGGCCTTGTTCAAA Chr10:84155748..84155767 60.37 50
downstream ENSMUSE00000465607 Chr10:84158300..84158458 TACACAAGACAACGCCCAAA Chr10:84158324..84158343 60.15 45
downstream ENSMUSE00000462904 Chr10:84159694..84159811 TGTGGGCATGGACTTGTTTA Chr10:84159746..84159765 59.96 45
downstream ENSMUSE00000468051 Chr10:84162144..84162286 GGAGTCTGTCGCACCTTTGT Chr10:84162168..84162187 60.31 55
downstream ENSMUSE00000291753 Chr10:84176374..84176477 TATGATGTCGGGACAGATGC Chr10:84176447..84176466 59.48 50
downstream ENSMUSE00000291749 Chr10:84176990..84177156 GCGAACGAGATCTTCACACA Chr10:84177109..84177128 59.99 50
downstream ENSMUSE00000291740 Chr10:84181155..84181268 GGTAAGGACAGCTCGTGGTC Chr10:84181269..84181288 59.73 60
downstream ENSMUSE00000100019 Chr10:84183089..84183262 CGCTCCATAGCCGATTAGAC Chr10:84183173..84183192 59.83 55
downstream ENSMUSE00000514755 Chr10:84188396..84189922 ACAGGCCCTTGACTGAGCTA Chr10:84189147..84189166 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAGTCACGCCTTCCAGATA Chr10:84105606..84105626 60.22 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAGTCACGCCTTCCAGATA Chr10:84105606..84105626 60.22 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034453