Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38219
Trapped Gene
Ralyl (ENSMUSG00000039717)
Vector Insertion
Chr 3: 13777308 - 13946394
Public Clones (sanger) (sanger) (sanger) (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 29% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000676524 (Chr3:13777297..13777307 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000676524 (Chr3:13777297..13777307 +)
Downstram Exon
ENSMUSE00000676523 (Chr3:13946395..13946532 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon ATTGGTTTGACCACGGAGAC Chr3:13946464..13946483 59.83 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000487654 Chr3:13776848..13777103 AAATCGTTGGCTGCTCTGTT Chr3:13776987..13777006 59.88 45
upstream ENSMUSE00000676524 Chr3:13777297..13777307 No primer for this exon

*** Putative Vector Insertion (Chr 3: 13777308 - 13946394) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000676523 Chr3:13946395..13946532 ATTGGTTTGACCACGGAGAC Chr3:13946464..13946483 59.83 50
downstream ENSMUSE00000306692 Chr3:14039714..14039789 TCCAGGCTTTGGTCTGTAGG Chr3:14039763..14039782 60.25 55
downstream ENSMUSE00000676522 Chr3:14039714..14039789 TCCAGGCTTTGGTCTGTAGG Chr3:14039763..14039782 60.25 55
downstream ENSMUSE00000362942 Chr3:14081208..14081240 ATGGCTCCTTTGATTCAAGC Chr3:14081230..14081249 59.27 45
downstream ENSMUSE00000410979 Chr3:14107219..14107266 No primer for this exon
downstream ENSMUSE00000306688 Chr3:14115693..14115856 GGTACACGGCCATGGTAATC Chr3:14115722..14115741 60.08 55
downstream ENSMUSE00000306682 Chr3:14129558..14129671 GCCTTTTGCTGCTTCTCAAT Chr3:14129666..14129685 59.6 45
downstream ENSMUSE00000378872 Chr3:14143274..14143446 ATCAGCTTCTTGCCCTCCTT Chr3:14143389..14143408 60.35 50
downstream ENSMUSE00000676520 Chr3:14143949..14143963 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACCAAGCCACTCTGAAAGGA Chr3:13843325..13843345 59.84 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGAAGGAAATCAAATGTGAAAAT Chr3:13843275..13843299 58.48 29.17 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039717