Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3822
Trapped Gene
Mtmr2 (ENSMUSG00000031918)
Vector Insertion
Chr 9: 13553845 - 13586720
Public Clones AZ0083 (sanger) E123F10 (ggtc) E123F10 (ggtc) IST14502H5 (tigm)
Private Clones OST150599 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000312286 (Chr9:13552863..13553844 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAAGCCGTCACATCTTGTGT Chr9:13553466..13553485 59.75 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000312286 (Chr9:13552863..13553844 +)
Downstram Exon
ENSMUSE00000214658 (Chr9:13586721..13586826 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAAGCCGTCACATCTTGTGT Chr9:13553466..13553485 59.75 50 TGCACCGAGTTCTCTGAATG Chr9:13586756..13586775 59.98 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000312286 Chr9:13552863..13553844 CAAGCCGTCACATCTTGTGT Chr9:13553466..13553485 59.75 50

*** Putative Vector Insertion (Chr 9: 13553845 - 13586720) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000214658 Chr9:13586721..13586826 TGCACCGAGTTCTCTGAATG Chr9:13586756..13586775 59.98 50
downstream ENSMUSE00000214652 Chr9:13590296..13590371 AACTTGTTTGCCTCCCTCAG Chr9:13590321..13590340 59.33 50
downstream ENSMUSE00000214650 Chr9:13593025..13593119 CTTGTGACAGTCAGCGTTCC Chr9:13593091..13593110 59.47 55
downstream ENSMUSE00000536674 Chr9:13593457..13593594 CAGTTTCCAGGCCATAGGAG Chr9:13593589..13593608 59.69 55
downstream ENSMUSE00000214657 Chr9:13593484..13593594 CAGTTTCCAGGCCATAGGAG Chr9:13593589..13593608 59.69 55
downstream ENSMUSE00000214643 Chr9:13596423..13596524 AGCAAATCGCAAGTTCCTGA Chr9:13596449..13596468 60.91 45
downstream ENSMUSE00000214637 Chr9:13597593..13597676 ACCCATTTTCGGGGAATACT Chr9:13597641..13597660 59.53 45
downstream ENSMUSE00000214645 Chr9:13599681..13599830 ACAACCAAGAGGGCAGGATA Chr9:13599766..13599785 59.55 50
downstream ENSMUSE00000638609 Chr9:13599681..13599859 ACAACCAAGAGGGCAGGATA Chr9:13599766..13599785 59.55 50
downstream ENSMUSE00000214655 Chr9:13600402..13600590 GGCCGAGCATCAAAGATAAA Chr9:13600568..13600587 60.17 45
downstream ENSMUSE00000474941 Chr9:13603594..13603779 TGGTGGGGTACACAATCTCC Chr9:13603723..13603742 60.63 55
downstream ENSMUSE00000703734 Chr9:13604298..13604526 CAGACTCGACCTTGTCAGCA Chr9:13604368..13604387 60.18 55
downstream ENSMUSE00000214656 Chr9:13604320..13604526 CAGACTCGACCTTGTCAGCA Chr9:13604368..13604387 60.18 55
downstream ENSMUSE00000585080 Chr9:13606359..13606451 CTGCGTCAGCATGGTTCTTA Chr9:13606398..13606417 60.01 50
downstream ENSMUSE00000214642 Chr9:13607869..13607982 TGAATTCAAATGCGGTAGGG Chr9:13607893..13607912 60.83 45
downstream ENSMUSE00000214639 Chr9:13609250..13609426 GCTGGCTACTGGGTAAAGGA Chr9:13609366..13609385 59.34 55
downstream ENSMUSE00000311975 Chr9:13609819..13610241 TGGGTTTTAAACACGGAAGG Chr9:13610066..13610085 59.83 45
downstream ENSMUSE00000558360 Chr9:13609819..13610925 TCTGACACAAGCCTCAATGC Chr9:13610362..13610381 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCATCCAACCATTTACCAT Chr9:13562852..13562872 59.36 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCATCCAACCATTTACCAT Chr9:13562852..13562872 59.36 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031918