Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38227
Trapped Gene
Wdr61 (ENSMUSG00000061559)
Vector Insertion
Chr 9: 54579193 - 54582290
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000716417 (Chr9:54582176..54582289 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAATGGTGGTCTTTGGTGCT Chr9:54582234..54582253 59.97 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000716417 (Chr9:54582176..54582289 -)
Downstram Exon
ENSMUSE00000712619 (Chr9:54579194..54579244 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAATGGTGGTCTTTGGTGCT Chr9:54582234..54582253 59.97 50 CCAAGGATGAAGCGCTAAAG Chr9:54579192..54579211 59.97 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000332152 Chr9:54582282..54582316 No primer for this exon
upstream ENSMUSE00000709403 Chr9:54582176..54582326 TGTACGGTGGTGAGTTGGTG Chr9:54582271..54582290 60.48 55
upstream ENSMUSE00000716417 Chr9:54582176..54582289 GAATGGTGGTCTTTGGTGCT Chr9:54582234..54582253 59.97 50
upstream ENSMUSE00000218391 Chr9:54579194..54579244 CTTTAGCGCTTCATCCTTGG Chr9:54579214..54579233 59.97 50
upstream ENSMUSE00000712619 Chr9:54579194..54579244 CTTTAGCGCTTCATCCTTGG Chr9:54579214..54579233 59.97 50

*** Putative Vector Insertion (Chr 9: 54579193 - 54582290) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000218387 Chr9:54578441..54578468 No primer for this exon
downstream ENSMUSE00000268207 Chr9:54575977..54576082 CCAGACCTTCACCAGGTCAT Chr9:54575960..54575979 59.96 55
downstream ENSMUSE00000218381 Chr9:54575396..54575568 AGTCCCAGAGGCGAATATGA Chr9:54575416..54575435 59.65 50
downstream ENSMUSE00000218380 Chr9:54572133..54572281 GGCCAGATACTGGGAGTCAG Chr9:54572213..54572232 59.68 60
downstream ENSMUSE00000268145 Chr9:54571858..54571951 CCAGGTATTTCCCATCAGGA Chr9:54571908..54571927 59.74 50
downstream ENSMUSE00000268114 Chr9:54570641..54570734 TCATCTGAAGCCGTGACAAG Chr9:54570643..54570662 59.98 50
downstream ENSMUSE00000218384 Chr9:54568067..54568159 No primer for this exon
downstream ENSMUSE00000218390 Chr9:54567058..54567136 TTGTTCCAACATCCCAAACC Chr9:54567074..54567093 60.59 45
downstream ENSMUSE00000534670 Chr9:54564971..54565242 TCCTGGTCATCTCCAACAGA Chr9:54565159..54565178 59.18 50
downstream ENSMUSE00000719237 Chr9:54562542..54564932 GATCCAATCGGAGTGAAGGA Chr9:54564218..54564237 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGGTCTTTAATCGCCTTGC Chr9:54582227..54582247 59.71 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TACGGTGGTGAGTTGGTGTG Chr9:54579267..54579287 60.48 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000061559