Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38229
Trapped Gene
2810407C02Rik (ENSMUSG00000075700)
Vector Insertion
Chr 3: 58394243 - 58394616
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000674839 (Chr3:58394089..58394242 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTCCATCCATGCAACAACTT Chr3:58394124..58394144 59.99 42.86 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000674839 (Chr3:58394089..58394242 +)
Downstram Exon
ENSMUSE00000674838 (Chr3:58394617..58397055 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTCCATCCATGCAACAACTT Chr3:58394124..58394144 59.99 42.86 TCTCCCATTGCAGTTCCTTC Chr3:58395878..58395897 60.19 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000674842 Chr3:58380558..58380795 GCGGCTGTCTCAATTACGAT Chr3:58380641..58380660 60.24 50
upstream ENSMUSE00000660055 Chr3:58380603..58380795 GCGGCTGTCTCAATTACGAT Chr3:58380641..58380660 60.24 50
upstream ENSMUSE00000660056 Chr3:58389153..58389263 GTTATCAGCCAGCGGTATCC Chr3:58389196..58389215 59.56 55
upstream ENSMUSE00000173238 Chr3:58389874..58390000 AGCTCCTAGCATCTGGCAGT Chr3:58389964..58389983 59.22 55
upstream ENSMUSE00000173240 Chr3:58392368..58392455 TCCTGAGCAACATGATTGAGA Chr3:58392393..58392413 59.38 42.86
upstream ENSMUSE00000660057 Chr3:58394086..58394213 CTTCCATCCATGCAACAACTT Chr3:58394124..58394144 59.99 42.86
upstream ENSMUSE00000674839 Chr3:58394089..58394242 CTTCCATCCATGCAACAACTT Chr3:58394124..58394144 59.99 42.86

*** Putative Vector Insertion (Chr 3: 58394243 - 58394616) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000674838 Chr3:58394617..58397055 TCTCCCATTGCAGTTCCTTC Chr3:58395878..58395897 60.19 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr3:58394293..58394313 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTACCTATCAGCACCGAAAA Chr3:58394216..58394237 59.23 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000075700