Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38235
Trapped Gene
Olfr56 (ENSMUSG00000040328)
Vector Insertion
Chr 11: 48900647 - 48931122
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000662602 (Chr11:48900536..48900646 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000662602 (Chr11:48900536..48900646 +)
Downstram Exon
ENSMUSE00000662601 (Chr11:48931123..48931616 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000679422 Chr11:48792391..48792492 No primer for this exon
upstream ENSMUSE00000662603 Chr11:48864235..48864336 No primer for this exon
upstream ENSMUSE00000662602 Chr11:48900536..48900646 No primer for this exon

*** Putative Vector Insertion (Chr 11: 48900647 - 48931122) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000662601 Chr11:48931123..48931616 No primer for this exon
downstream ENSMUSE00000679421 Chr11:48931123..48931623 No primer for this exon
downstream ENSMUSE00000662600 Chr11:48937786..48937813 No primer for this exon
downstream ENSMUSE00000679420 Chr11:48941321..48941431 No primer for this exon
downstream ENSMUSE00000662599 Chr11:48941337..48941431 No primer for this exon
downstream ENSMUSE00000711199 Chr11:48947790..48948889 No primer for this exon
downstream ENSMUSE00000722234 Chr11:48947790..48948889 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATCTGGTGAGTGCGAAAAGC Chr11:48924643..48924663 60.41 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATCTGGTGAGTGCGAAAAGC Chr11:48924643..48924663 60.41 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040328