Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38256
Trapped Gene
Usp18 (ENSMUSG00000030107)
Vector Insertion
Chr 6: 121196081 - 121202334
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000553161 (Chr6:121195925..121196080 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTCGCTCTTTGGCTTGACT Chr6:121196050..121196069 59.76 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000553161 (Chr6:121195925..121196080 +)
Downstram Exon
ENSMUSE00000553158 (Chr6:121202335..121202589 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTCGCTCTTTGGCTTGACT Chr6:121196050..121196069 59.76 50 ACAAGCCGGAGACAAATGAC Chr6:121202360..121202379 60.12 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000553161 Chr6:121195925..121196080 CTTCGCTCTTTGGCTTGACT Chr6:121196050..121196069 59.76 50

*** Putative Vector Insertion (Chr 6: 121196081 - 121202334) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000553158 Chr6:121202335..121202589 ACAAGCCGGAGACAAATGAC Chr6:121202360..121202379 60.12 50
downstream ENSMUSE00000553155 Chr6:121203780..121203876 CAACACGTCTGTCCGATGTT Chr6:121203819..121203838 59.6 50
downstream ENSMUSE00000288904 Chr6:121205282..121205427 GCACTCCGAGGCACTGTTAT Chr6:121205305..121205324 60.28 55
downstream ENSMUSE00000195356 Chr6:121211073..121211152 TCTGTGTCCGTGATCTGGTC Chr6:121211151..121211170 59.67 55
downstream ENSMUSE00000195357 Chr6:121211385..121211531 AGGCTTTGCGTCCTTATCAA Chr6:121211522..121211541 59.85 45
downstream ENSMUSE00000195354 Chr6:121212120..121212212 CACATGTCGGAGCTTGCTAA Chr6:121212178..121212197 60.01 50
downstream ENSMUSE00000195359 Chr6:121212677..121212844 TGGTATCACCGAGGTCTTCC Chr6:121212839..121212858 59.93 55
downstream ENSMUSE00000195355 Chr6:121218564..121218695 CAATCACGGCAAAGAGTTCA Chr6:121218600..121218619 59.84 45
downstream ENSMUSE00000195360 Chr6:121219116..121219165 ACTGGACATCCTTCCAGGTG Chr6:121219140..121219159 59.96 55
downstream ENSMUSE00000350840 Chr6:121220490..121220934 GTTGTATCCCCCACATTTGC Chr6:121220867..121220886 60.06 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCGCCAGAACTTTGCTAAT Chr6:121202116..121202136 59.85 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCAGTGGAGTGGACACCTTT Chr6:121202036..121202056 60 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030107