Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38258
Trapped Gene
Kcnj6 (ENSMUSG00000043301)
Vector Insertion
Chr 16: 94982686 - 95054827
Public Clones (sanger) (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 75% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000373003 (Chr16:95053906..95054826 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAACCTCAACGGGTTTGTCT Chr16:95054431..95054450 60.01 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000373003 (Chr16:95053906..95054826 -)
Downstram Exon
ENSMUSE00000511382 (Chr16:94982687..94984292 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAACCTCAACGGGTTTGTCT Chr16:95054431..95054450 60.01 50 TTGGGCACAATGAAGGTACA Chr16:94983628..94983647 59.96 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000641982 Chr16:95218794..95219303 ACGTCTCCCTGCAAGGTCTA Chr16:95219245..95219264 59.87 55
upstream ENSMUSE00000616537 Chr16:95162788..95162836 GAAGAAATGACAATGGCCAAG Chr16:95162804..95162824 59.56 42.86
upstream ENSMUSE00000555104 Chr16:95055204..95055234 GCAGGCAGAACTGCTTGAAT Chr16:95055210..95055229 60.55 50
upstream ENSMUSE00000373003 Chr16:95053906..95054826 CAACCTCAACGGGTTTGTCT Chr16:95054431..95054450 60.01 50
upstream ENSMUSE00000697238 Chr16:94984005..94984292 TGCCTCTGAGTTGGTCTGTG Chr16:94984084..94984103 60.02 55
upstream ENSMUSE00000511382 Chr16:94982687..94984292 TGCCTCTGAGTTGGTCTGTG Chr16:94984084..94984103 60.02 55

*** Putative Vector Insertion (Chr 16: 94982686 - 95054827) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000697237 Chr16:94970290..94970877 GATGGGTTGGGTGAATTCTG Chr16:94970721..94970740 60.17 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCAGTCCTGTGAGACCCAAA Chr16:95015826..95015846 59.23 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCAGTCCTGTGAGACCCAAA Chr16:95015826..95015846 59.23 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000043301