Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38266
Trapped Gene
Gm129 (ENSMUSG00000038550)
Vector Insertion
Chr 3: 95682425 - 95684444
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 55% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000472110 (Chr3:95684332..95684443 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000472110 (Chr3:95684332..95684443 -)
Downstram Exon
ENSMUSE00000413084 (Chr3:95682426..95683072 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000588476 Chr3:95686078..95686151 No primer for this exon
upstream ENSMUSE00000408085 Chr3:95685104..95685512 No primer for this exon
upstream ENSMUSE00000250497 Chr3:95684906..95684981 No primer for this exon
upstream ENSMUSE00000250490 Chr3:95684558..95684636 No primer for this exon
upstream ENSMUSE00000472110 Chr3:95684332..95684443 No primer for this exon
upstream ENSMUSE00000413084 Chr3:95682426..95683072 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCAGGTGGAAGGGATGTTAAA Chr3:95684397..95684418 61.21 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACTCGTGACTGGGAAAACC Chr3:95684377..95684397 59.56 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038550