Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38267
Trapped Gene
Fkbp15 (ENSMUSG00000066151)
Vector Insertion
Chr 4: 61975287 - 61980033
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000632397 (Chr4:61979976..61980032 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000632397 (Chr4:61979976..61980032 -)
Downstram Exon
ENSMUSE00000526790 (Chr4:61975288..61975459 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CTTCTGGTGAGCCGTCATTT Chr4:61975360..61975379 60.26 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000526782 Chr4:62021404..62021496 ATGACACCGACTTCCTCTCG Chr4:62021415..62021434 60.26 55
upstream ENSMUSE00000632398 Chr4:62021404..62021568 ATGACACCGACTTCCTCTCG Chr4:62021415..62021434 60.26 55
upstream ENSMUSE00000673191 Chr4:62021404..62021582 ATGACACCGACTTCCTCTCG Chr4:62021415..62021434 60.26 55
upstream ENSMUSE00000526781 Chr4:62013467..62013579 CAACTATGGGCCATGGAAAT Chr4:62013525..62013544 59.65 45
upstream ENSMUSE00000526780 Chr4:62007091..62007175 CACGTCCTCAGTGCTGTTTG Chr4:62007116..62007135 60.5 55
upstream ENSMUSE00000526779 Chr4:62006542..62006611 AATATGCAAAGCAGGGCAAA Chr4:62006581..62006600 60.59 40
upstream ENSMUSE00000526778 Chr4:62001656..62001730 GCAGCCAGTGACTGTTGCTA Chr4:62001682..62001701 60.21 55
upstream ENSMUSE00000526777 Chr4:62001268..62001366 TTCGGCCCAATAACTACAGC Chr4:62001346..62001365 60.1 50
upstream ENSMUSE00000526776 Chr4:61999520..61999669 GTGTGTGGCCAAGTGCAATA Chr4:61999648..61999667 60.58 50
upstream ENSMUSE00000526775 Chr4:61998091..61998159 AACAAAGATAAGCCGCTTCG Chr4:61998122..61998141 59.5 45
upstream ENSMUSE00000526801 Chr4:61997435..61997581 GGCTTAGAGGACGGGCTACT Chr4:61997562..61997581 59.87 60
upstream ENSMUSE00000526800 Chr4:61995155..61995294 GCCTCTCTGCTGATCCTGTT Chr4:61995187..61995206 59.56 55
upstream ENSMUSE00000526799 Chr4:61994717..61994774 CGGGTCTTCGTTCCAAATCT Chr4:61994750..61994769 61.37 50
upstream ENSMUSE00000526798 Chr4:61993225..61993332 GCTGATCTCGAGGATGGCTA Chr4:61993290..61993309 60.47 55
upstream ENSMUSE00000526797 Chr4:61990382..61990484 TACCACAGATGGCCTCACAG Chr4:61990383..61990402 59.7 55
upstream ENSMUSE00000526796 Chr4:61988847..61988953 CACCTCAGCCATCTGGTTCT Chr4:61988934..61988953 60.26 55
upstream ENSMUSE00000526795 Chr4:61987093..61987207 AGCCTATGCATATCCCCAGA Chr4:61987171..61987190 59.51 50
upstream ENSMUSE00000526794 Chr4:61985146..61985255 TGAAATTCGAATGGCAGTCA Chr4:61985184..61985203 60.2 40
upstream ENSMUSE00000526793 Chr4:61984231..61984338 CTGGCAACTCCATGCTTCTT Chr4:61984294..61984313 60.4 50
upstream ENSMUSE00000526792 Chr4:61983217..61983311 CTCATTGAACGCAACCAGAG Chr4:61983217..61983236 59.44 50
upstream ENSMUSE00000673187 Chr4:61982023..61982095 GAACAACTCGCTTCAAACAGC Chr4:61982039..61982059 60.05 47.62
upstream ENSMUSE00000526791 Chr4:61981993..61982095 GAACAACTCGCTTCAAACAGC Chr4:61982039..61982059 60.05 47.62
upstream ENSMUSE00000673185 Chr4:61981676..61982095 CCTGTAACCCCAGGTTCTCA Chr4:61981741..61981760 59.96 55
upstream ENSMUSE00000632397 Chr4:61979976..61980032 No primer for this exon
upstream ENSMUSE00000526790 Chr4:61975288..61975459 AAATGACGGCTCACCAGAAG Chr4:61975382..61975401 60.26 50

*** Putative Vector Insertion (Chr 4: 61975287 - 61980033) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000526789 Chr4:61973292..61973428 TCGGAGGTCAGTCAGCTCTT Chr4:61973294..61973313 60.13 55
downstream ENSMUSE00000673190 Chr4:61972306..61973428 AATCAGCTACGCCTGCACTT Chr4:61973218..61973237 60.04 50
downstream ENSMUSE00000526788 Chr4:61968972..61969127 TGTGACTTGCGAATCTCGTC Chr4:61969026..61969045 59.99 50
downstream ENSMUSE00000526787 Chr4:61967929..61968081 CTCAGCCTGTGCAAGAGTCA Chr4:61968039..61968058 60.33 55
downstream ENSMUSE00000526786 Chr4:61966944..61967063 GTCTTCTCCAGTCGCTGCAT Chr4:61966971..61966990 60.56 55
downstream ENSMUSE00000526785 Chr4:61966157..61966264 CTCAGAATGGTCCCTCCATC Chr4:61966157..61966176 59.46 55
downstream ENSMUSE00000526784 Chr4:61965225..61965940 CAGGGGCTTCTTCTCCTCTT Chr4:61965838..61965857 59.95 55
downstream ENSMUSE00000603996 Chr4:61964195..61964291 CCTCGGAACTTTCAGAGTCG Chr4:61964212..61964231 59.98 55
downstream ENSMUSE00000603995 Chr4:61961377..61962024 TCCTCTTCAGCAGGTCAGGT Chr4:61961749..61961768 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTGCAGGCCTACTGGGGTA Chr4:61980018..61980038 61.98 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TATTCCGTGACTGGGAAAACC Chr4:61979966..61979987 61.08 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000066151