Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38279
Trapped Gene
Rnf10 (ENSMUSG00000041740)
Vector Insertion
Chr 5: 115692642 - 115694131
Public Clones (sanger) (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 90% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000268074 (Chr5:115694030..115694130 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTGGGAGTCTGGAAGACGAC Chr5:115694054..115694073 60.24 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000268074 (Chr5:115694030..115694130 -)
Downstram Exon
ENSMUSE00000268066 (Chr5:115692643..115692700 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTGGGAGTCTGGAAGACGAC Chr5:115694054..115694073 60.24 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000690452 Chr5:115722355..115722380 No primer for this exon
upstream ENSMUSE00000650744 Chr5:115722328..115722903 GAAAAATGTCGCCATGAAGG Chr5:115722531..115722550 60.45 45
upstream ENSMUSE00000650743 Chr5:115722266..115722326 GGCGAGTCTAAACCCAAGAG Chr5:115722268..115722287 58.93 55
upstream ENSMUSE00000690456 Chr5:115722266..115722901 GAAAAATGTCGCCATGAAGG Chr5:115722531..115722550 60.45 45
upstream ENSMUSE00000690459 Chr5:115722266..115722907 GAAAAATGTCGCCATGAAGG Chr5:115722531..115722550 60.45 45
upstream ENSMUSE00000709339 Chr5:115722266..115722901 GAAAAATGTCGCCATGAAGG Chr5:115722531..115722550 60.45 45
upstream ENSMUSE00000268179 Chr5:115710128..115710324 TTACAATCGCAAGCGTGAAC Chr5:115710277..115710296 59.88 45
upstream ENSMUSE00000690450 Chr5:115710128..115710158 No primer for this exon
upstream ENSMUSE00000268172 Chr5:115706983..115707182 GAGTTTAGCCCTGCCCAGTT Chr5:115707142..115707161 60.63 55
upstream ENSMUSE00000268168 Chr5:115705359..115705449 TCACTTTGCTGACCCTGACA Chr5:115705391..115705410 60.44 50
upstream ENSMUSE00000268162 Chr5:115701286..115701470 CCTACTGCGGCCAAGATAAC Chr5:115701403..115701422 59.73 55
upstream ENSMUSE00000268151 Chr5:115701075..115701211 TTGCCACAGAGTCTCGACAG Chr5:115701187..115701206 60.18 55
upstream ENSMUSE00000268142 Chr5:115699979..115700139 GCTCAGCCAGTATTCCAAGC Chr5:115700113..115700132 59.99 55
upstream ENSMUSE00000268120 Chr5:115699406..115699531 GGGAAGAAGCTCTGTCAGGA Chr5:115699508..115699527 59.53 55
upstream ENSMUSE00000268111 Chr5:115698924..115699179 CAGGAGGAGCCCATCACTAA Chr5:115698974..115698993 60.21 55
upstream ENSMUSE00000650742 Chr5:115698924..115699182 CAGGAGGAGCCCATCACTAA Chr5:115698974..115698993 60.21 55
upstream ENSMUSE00000268104 Chr5:115698591..115698724 GCAACCGTGGTAGAGATTGC Chr5:115698610..115698629 60.67 55
upstream ENSMUSE00000268096 Chr5:115697178..115697295 GCATCTGTGAACTGGCTCTG Chr5:115697221..115697240 59.58 55
upstream ENSMUSE00000268090 Chr5:115696889..115696990 AGAGCGCAGAATTGAGATGG Chr5:115696913..115696932 60.5 50
upstream ENSMUSE00000268085 Chr5:115695858..115696013 TTCCCCTCGAGAACCTACAG Chr5:115695979..115695998 59.28 55
upstream ENSMUSE00000268074 Chr5:115694030..115694130 TTGGGAGTCTGGAAGACGAC Chr5:115694054..115694073 60.24 55
upstream ENSMUSE00000268066 Chr5:115692643..115692700 CCCAAAACTGCTCCAAAGAA Chr5:115692645..115692664 60.22 45

*** Putative Vector Insertion (Chr 5: 115692642 - 115694131) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000453219 Chr5:115692402..115692560 AAGGCTGCTTCGATAGCTTG Chr5:115692421..115692440 59.75 50
downstream ENSMUSE00000495809 Chr5:115691786..115692070 GCCCCAAGCTAATCAATCTG Chr5:115691867..115691886 59.67 50
downstream ENSMUSE00000690447 Chr5:115691782..115692067 GCCCCAAGCTAATCAATCTG Chr5:115691867..115691886 59.67 50
downstream ENSMUSE00000690454 Chr5:115691779..115692067 GCCCCAAGCTAATCAATCTG Chr5:115691867..115691886 59.67 50
downstream ENSMUSE00000690458 Chr5:115691421..115692070 TGTAAAGAGGGGAAGCTGGA Chr5:115691786..115691805 59.81 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTCTGCTGACCCCTCTGTC Chr5:115694107..115694127 60.39 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTCTGCTGACCCCTCTGTC Chr5:115694107..115694127 60.39 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041740