Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38287
Trapped Gene
Usp12 (ENSMUSG00000029640)
Vector Insertion
Chr 5: 147551877 - 147563355
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 66% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000647753 (Chr5:147563271..147563354 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAAGCAGGAAGCACACAAGC Chr5:147563272..147563291 62.11 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000647753 (Chr5:147563271..147563354 -)
Downstram Exon
ENSMUSE00000533711 (Chr5:147551878..147552067 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAAGCAGGAAGCACACAAGC Chr5:147563272..147563291 62.11 55 GCATCTCCTGACGTGTTGAA Chr5:147551902..147551921 59.84 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000711990 Chr5:147606191..147606532 TTCGCCTCCATCTGTACCAT Chr5:147606192..147606211 60.48 50
upstream ENSMUSE00000714055 Chr5:147606191..147606532 TTCGCCTCCATCTGTACCAT Chr5:147606192..147606211 60.48 50
upstream ENSMUSE00000376315 Chr5:147580513..147580593 AGAACAGTTTCCGGTCAACG Chr5:147580536..147580555 60.15 50
upstream ENSMUSE00000589481 Chr5:147580513..147580593 CCGGTCAACGAGCACTATTT Chr5:147580526..147580545 60.13 50
upstream ENSMUSE00000263651 Chr5:147574777..147574990 ACAAGGTTGCGGAAAGAAAA Chr5:147574779..147574798 59.72 40
upstream ENSMUSE00000486429 Chr5:147574777..147574990 ACAAGGTTGCGGAAAGAAAA Chr5:147574779..147574798 59.72 40
upstream ENSMUSE00000190971 Chr5:147565946..147566175 CTGGGTCCACGAGATCTTTC Chr5:147565990..147566009 59.65 55
upstream ENSMUSE00000589480 Chr5:147565946..147566175 GGTCCACGAGATCTTTCAGG Chr5:147565987..147566006 59.65 55
upstream ENSMUSE00000647754 Chr5:147563469..147563545 CTGTTGACGTGGAACAAAACA Chr5:147563491..147563511 59.64 42.86
upstream ENSMUSE00000647753 Chr5:147563271..147563354 CAAGCAGGAAGCACACAAGC Chr5:147563272..147563291 62.11 55
upstream ENSMUSE00000533711 Chr5:147551878..147552067 TTCAACACGTCAGGAGATGC Chr5:147551924..147551943 59.84 50

*** Putative Vector Insertion (Chr 5: 147551877 - 147563355) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000263626 Chr5:147551870..147552067 GCATCTCCTGACGTGTTGAA Chr5:147551902..147551921 59.84 50
downstream ENSMUSE00000647752 Chr5:147551870..147551875 No primer for this exon
downstream ENSMUSE00000533709 Chr5:147550676..147550754 AATATAATGGCCTCGGTTGG Chr5:147550708..147550727 58.78 45
downstream ENSMUSE00000533718 Chr5:147550676..147550754 AATATAATGGCCTCGGTTGG Chr5:147550708..147550727 58.78 45
downstream ENSMUSE00000510269 Chr5:147546388..147549356 AACGACAATCCCCTGAAGTG Chr5:147547013..147547032 59.97 50
downstream ENSMUSE00000647751 Chr5:147546388..147549356 AACGACAATCCCCTGAAGTG Chr5:147547013..147547032 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAAGGCCAGCGTGTAAAGTA Chr5:147563302..147563322 58.99 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGTCGTGACTGGGAAAACC Chr5:147563288..147563308 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029640